Prions
Mad Cow Home ... Best Links ... Search this site

Promoter up-mutations in amyloid 'chaparone' triple Alzheimer risk
Transcriptional errors accumulate about GAGAG
nvCJD and bovine pituitary growth hormone
BSE and Prions: Uncertainties About the Agent
BSE and Prions: Uncertainties About the Article
Briefly noted: prion oligomer literature, GPI viral receptors

Researchers Discover New Genetic Risk For Alzheimer's Disease

Washington University School Of Medicine 12/30/97
Contact: Jim Dryden , Public Information Officer 
Phone: 314-286-0110
The paper below gives indirect support to earlier speculation that similar mechanisms are operative in sporadic CJD or nvCJD. The full human prion promoter region has not sequenced in nvCJD cases and there is even reason to doubt, based on hamster, that the number of exons has been correctly determined in a tissue-specific expression sense. Much data supports early onset in over-expresssion situations. The earliest nvCJD victims, in this scenario, potentially are genetically abnormal in having up-promoters, though as shown with Alzheimer below, these wouldn't necessarily have to be in the prion gene itself. It would be of interest to determine the allele status of APOE in sporadic CJD since some interaction is in the record. -- webmaster

APOE and Alzheimer's-disease story becomes more complicated

Jane Bradbury Lancet 3 Jan 98 commentary (Nat Genet 1998; 18: 69-71)
The association between the epsilon4 allele of the apolipoprotein-E gene (APOE) and an increased risk of developing Alzheimer's disease (AD) is well known. But now, researchers from Spain and the USA reveal that a genetic polymorphism in the transcriptional regulation region of APOE may also be linked with AD risk. Their results provide new insight into the disease process and may help in the search for therapeutic drug targets.

The authors studied an A/T polymorphism at position -491 of the APOE transcriptional regulatory unit in two populations of European descent (Spanish and North American). In each of the case-control clinical populations, the -491 AA genotype was associated with an increased risk for AD when compared with the AT and TT genotypes combined. In the Spanish population, the increased risk was more than three-fold, but the association was weaker for the US population (OR 1.81). The association of -491 AA with AD was independent of APOE4 status.

The researchers report that, in-vitro, the -491A allele is associated with higher constitutive APOE transcription. Recent mouse-model data, notes Goate, have shown that ■-amyloid deposition correlates with APOE expression. Although apolipoprotein E in the cerebrospinal fluid is thought to protect neuronal cells from ■-amyloid peptides, increased amounts of the protein are cytotoxic. Taken together, "these results suggest that higher amounts of apolipoprotein A might lead to cell death and to more ■-amyloid deposition", says Goate.

St. Louis -- Investigators at Washington University School of Medicine in St. Louis and the University of Madrid, Spain, have found a genetic variation that appears to increase the risk of developing Alzheimer's disease.

This finding provides a link between two substances previously implicated in the disease - APOE, a cholesterol-carrying protein, and beta-amyloid, a protein that forms plaques in the brain. Replicating the results of this preliminary study would raise hopes that drugs in the pipeline may be effective against the disorder, which affects about 4 million Americans.

Since 1993, scientists have known of a relationship between the APOE gene and Alzheimer's disease. But no one knew of a mechanism by which APOE might lead to the disorder. In addition, there are several forms of APOE, but only the form known as APOE e4 was closely related to the risk for Alzheimer's disease. The new study, reported in the January 1998 issue of Nature Genetics, shows that other forms of APOE also can increase the risk of Alzheimer's disease and suggests how this might happen.

"We've discovered changes in the APOE gene that can alter your risk, and we found those changes in the regulatory part of the gene, which controls how much APOE protein our cells produce," said Alison M. Goate, Ph.D., associate professor of genetics in psychiatry and a lead author of the study.

In both the American and the Spanish subjects, the investigators found three normal variations, or polymorphisms, in the promoter region of the APOE gene. The promoter is a stretch of DNA that determines how active a gene becomes. One of the genetic variations was linked to a higher frequency of Alzheimer's disease. It caused a higher level of expression of APOE, regardless of whether the APOE gene was the e4 variety. Subjects with this polymorphism were approximately three times more likely to have Alzheimer's disease than those who did not have the variation. When the researchers removed the data from subjects who carried an APOE e4 gene, the risk was four times higher than in people without the polymorphism.

In animal models of the disease, other researchers have shown that increased APOE levels can raise the amount of amyloid that's deposited in Alzheimer plaques. "So it would seem that a likely explanation for our data is that by increasing the level of APOE expression, this polymorphism might increase the amount of amyloid you deposit in your brain. In turn, that could increase your risk of getting Alzheimer's disease," Goate suggested. Amyloid protein contributes to the development of senile plaques, which dot the brain's cortex in Alzheimer patients. Little is understood about the causes of these deposits.

"From our data, we might predict that APOE acts as a chaperon for the amyloid protein. With what we know from in vitro studies, it would make sense that APOE is inducing more of the normally soluble amyloid to deposit in the brain as plaques," Goate explained. "I think this is the first result that has really suggested a connection between APOE expression and amyloid deposition, and it makes me more optimistic that the drugs being developed to inhibit amyloid production or deposition may be effective therapies for Alzheimer's disease."

Next, Goate and colleagues will try to determine whether the genetic variation in APOE really does increase amyloid deposition. Studying brains postmortem, Goate hopes to learn whether individuals who had the high-expressing APOE variation also had higher levels of amyloid in the brain.

Goate does not believe that this variation in the APOE gene is sufficient to cause Alzheimer's disease on its own. "I think several genes will turn out to be involved in Alzheimer's diseases in the plural," she said. "There may be many different ways of producing the dementia that we associate with the disease, but this could be teaching us about one of them."

Frameshift Mutants of Amyloid Precursor Protein and Ubiquitin-B in Alzheimer's and Down Patients

Science 9 Jan 98 279:242-247 
Fred W. van Leeuwen, ... J. Peter H. Burbach, Elly M. Hol 
Fulltext
The cerebral cortex of Alzheimer's and Down syndrome patients is characterized by the presence of protein deposits in neurofibrillary tangles, neuritic plaques, and neuropil threads. These structures were shown to contain forms of beta amyloid precursor protein and ubiquitin-B that are aberrant (+1 proteins) in the carboxyl terminus. The +1 proteins were not found in young control patients, whereas the presence of ubiquitin-B+1 in elderly control patients may indicate early stages of neurodegeneration. The two species of +1 proteins displayed cellular colocalization, suggesting a common origin, operating at the transcriptional level or by posttranscriptional editing of RNA. This type of transcript mutation is likely an important factor in the widely occurring nonfamilial early- and late-onset forms of Alzheimer's disease.

Commentary

Gretchen Vogel  9 Jan 98 Science p 174
Scientists usually blame errors in protein structure on mistakes in the DNA--the genes that are passed on from one generation to the next and provide the blueprints for proteins. But as any manufacturer knows, mistakes can arise not only in the blueprint, but also on the production line. A team of Dutch scientists reports on page 242 that aging cells seem to be plagued by mistakes in protein assembly, possibly contributing to the brain degeneration characteristic of Alzheimer's disease (AD).

Fred van Leeuwen and his colleagues at the Netherlands Institute for Brain Research in Amsterdam have found a new kind of faulty protein in the abnormal plaques and tangles that are hallmarks of Alzheimer's brain pathology. While 40% of Alzheimer's cases apparently arise from specific gene mutations, there seems to be nothing wrong with the DNA blueprints for these proteins. The scientists theorize that the mistakes arose during protein synthesis--and that such mistakes may help cause Alzheimer's in the majority of patients.

Some researchers caution that the results are preliminary and are based on tests that could be misleading. But others, including Zaven Khachaturian, who is a scientific adviser for the Alzheimer's Association, say that if it is right, the work could help explain why age is the greatest risk factor for developing AD--because the protein errors would presumably increase with time.

And the findings may have even wider importance. Similar mistakes could take place in thousands of proteins, says Rudolph Tanzi of Harvard University, contributing not only to other age-associated diseases, but also to aging in general. If so, he says, the finding would have "profound implications beyond the genes that they're looking at."

The team first found evidence for such protein-synthesis mistakes more than 10 years ago in an unusual breed of rat, which carries a mutation in a gene that helps regulate urine production. As expected, those rats produced none of the normal protein at birth, but surprisingly, as the animals aged, more and more of the normal protein showed up in their brain cells.

A closer look at both the DNA of the gene and the messenger RNA (mRNA) transcribed from it, which tells the cell to make the corresponding protein, provided an explanation. The scientists found that the mutation itself--a loss of a single base pair that shifts the genetic code by one, totally garbling the instructions for making the protein--was still present. But some of the mRNA had acquired a compensating mistake: In decoding the RNA, the cell had misread a "GAGAG" sequence, shortening it by two bases to "GAG." Because three bases code for one amino acid--the actual building blocks of proteins--the loss of two more bases restored the proper reading frame and produced a functioning protein.

In subsequent work, the team found evidence for the same type of GA deletions in mRNAs in the brains of normal aging rats and humans. Because GAGAG, the sequence that is prone to being misread, shows up in mRNAs coding for hundreds of different proteins, van Leeuwen and his colleagues decided to search for other proteins affected by frameshift errors. They looked at two proteins involved in Alzheimer's disease: amyloid precursor protein (APP) and ubiquitin. No one knows exactly what the APP does normally, but it can be cleaved to produce a smaller protein-- amyloid--that is abundant in Alzheimer's plaques. Ubiquitin is a garbage-disposal protein, marking faulty proteins for degradation and disposal in the cell. It, too, is common in Alzheimer's plaques and also in tangles.

To see if mutant proteins were present in AD brains, the scientists synthesized the theoretical proteins that would result from GA deletions and injected them separately into rabbits, which produced antibodies to the proteins. The scientists then applied the antibodies to brain samples from Alzheimer's patients and people with Down syndrome, who develop early symptoms of AD. The antibodies reacted with their target proteins in almost all the Alzheimer's and Down samples, and in elderly nondemented controls with early signs of plaques and tangles. Samples from young controls showed no reactivity.

The researchers then took a closer look at the proteins stained by the antibodies. In mixtures of proteins from Down and AD patients' brains, the team's antibody stained a 38-kilodalton protein--the size expected of the APP mutant, because the frameshift produces an early stop signal that makes the mutant roughly half as big as the normal protein. In addition, analysis of mRNAs turned up examples of GA deletions in all of the AD and Down syndrome patients studied.

The scientists speculate that as cells age, the protein assembly line becomes more error-prone, causing mutated proteins to build up and somehow damage cells. For example, the loss of normal ubiquitin could allow the cell to choke on faulty or unneeded proteins. "It's like when the garbage can is not emptied," says van Leeuwen. "It causes big problems for the cell."

How a shortened APP could contribute to the disease is harder to explain. Indeed, a shortened protein might even interfere with a mechanism most Alzheimer's researchers favor: They believe that abnormal cleavage of APP produces a longer than normal form of amyloid, which tends to form toxic deposits that eventually kill brain cells. But the shortened version of APP might not be able to produce amyloid at all, says John Hardy of the Mayo Clinic in Jacksonville, Florida.

Indeed, Hardy isn't convinced that altered APP and ubiquitin are present in diseased brains. The brain cells affected by Alzheimer's are so damaged, he says, that the antibodies could be staining many things besides the mutant APP and ubiquitin. And even if the mutant proteins are present, he says, "they are much more likely to be an effect than a cause" of AD brain damage. While van Leeuwen concedes that it's unclear how the GA deletion in APP might lead to AD, he says there are several possibilities. For example, the mutant protein might disrupt the processing of the normal protein so that it produces the longer form of amyloid.

The current evidence is already enough to intrigue Khachaturian. The work "puts [AD] in a different frame of reference." he says, and provides a plausible connection between AD and aging. Caleb Finch of the University of Southern California in Los Angeles adds that he, for one, will pay close attention to errors in protein synthesis. The finding raises "many perplexing mysteries," he says, "but their resolution will be the basis for a whole new set of hypotheses" about how the disease causes its devastation.

Commentary: possible relevence to CJD

9 Jan 98 webmaster
This data supports age-related accummulation and propensity for transcriptional errors as a cause of Alzheimer's. . In Alzheimer's APP and other genes, the problem is consistently associated with a pentanucleotide GAGAG with a dinculeotide repeat. Slippage occurs on the AG pair resulting in a frameshift resulting in abnormally processed protein resulting in beta-amyloid.

I looked at human prion protein: it contains two GAGAG streches rather late on, bovine and ovine have one each. The GAG is in register so there is no effect on the first amino acid. The frameshift effect in humans is ERESQAYYQRGSSMVLFSSPPVILLISFLIFLIVG- to EGISGLLPERIEHGPLLLSTCDPPDLFPHLPDSGM...

This makes some sense as a source of some fraction of sporadic disease, but needs whole lot more work (such as transgenic mouse making 'aged' mRNA >from the get-to). Certainly would lose GPI-anchoring potential and presumbably exportability.

human
atggcgaaccttggctgctggatgctggttctctttgtggccacatggagtgacctgggcctctgcaagaagcgcccgaagcctggaggatggaacactgggggcagccgatacccggggcagggcagccctggag
gcaaccgctacccacctcagggcggtggtggctgggggcagcctcatggtggtggctgggggcagcctcatggtggtggctgggggcagccccatggtggtggctggggacagcctcatggtggtggctggggtca
aggaggtggcacccacagtcagtggaacaagccgagtaagccaaaaaccaacatgaagcacatggctggtgctgcagcagctggggcagtggtggggggccttggcggctacatgctgggaagtgccatgagcag
gcccatcatacatttcggcagtgactatgaggaccgttactatcgtgaaaacatgcaccgttaccccaaccaagtgtactacaggcccatggatgagtacagcaaccagaacaactttgtgcacgactgcgtcaata
tcacaatcaagcagcacacggtcaccacaaccaccaagggggagaacttcaccgagaccgacgttaagatgatggagcgcgtggttgagcagatgtgtatcacccagtacGAGAGggaatctcaggcctattaccaGAGAGgatcgagcatggtcctcttctcctctccacctgtgatcctcctgatctctttcctcatcttcctgatagtgggatga

cow
atggtgaaaagccacataggcagttggatcctggttctctttgtggccatgtggagtgacgtgggcctctgcaagaagcgaccaaaacctggcggaggatggaacactggggggagccgatacccgggacagggcagt
cctggaggcaaccgctatccacctcagggagggggtggctggggtcagccccatggaggtggctggggccagcctcatggaggtggctggggtcagccccatggtggtggctggggacagccacatggtggtggaggc
tggggtcaaggtggtagccacagtcagtggaacaaacccagtaagccaaaaaccaacatgaagcatgtggcaggagctgctgcagctggagcagtggtagggggccttggtggctacatgctgggaagtgccatgagc
aggcctcttatacattttggcaatgactatgaggaccgttactatcgtgaaaacatgcaccgttaccccaaccaagtgtactacaggccagtggatcagtatagtaaccagaacaactttgtgcatgactgtgtcaacatc
acagtcaaggaacacacagtcaccaccaccaccaagggggagaacttcaccgaaactgacatcaagatgatggagcgagtggtggagcaaatgtgcattacccagtaccaGAGAGaatcccaggcttattaccaacgaggggcaagtgtgatcctcttctcttcccctcctgtgatcctcctcatctctttcctcatttttctcatagtaggatag

sheep
atggtgaaaagccacataggcagttggatcctggttctctttgtggccatgtggagtgacgtgggcctctgcaagaagcgaccaaaacctggcggaggatggaacactggggggagccgatacccgggacagggcagtc
ctggaggcaaccgctatccacctcagggagggggtggctggggtcagccccatggaggtggctggggccaacctcatggaggtggctggggtcagccccatggtggtggctggggacagccacatggtggtggaggctg
gggtcaaggtggtagccacagtcagtggaacaagcccagtaagccaaaaaccaacatgaagcatgtggcaggagctgctgcagctggagcagtggtagggggccttggtggctacatgctgggaagtgccatga
gcaggcctcttatacattttggcaatgactatgaggaccgttactatcgtgaaaacatgtaccgttaccccaaccaagtgtactacagaccagtggatcagtatagtaaccagaacaactttgtgcatgactgtgtcaaca
tcacagtcaagcaacacacagtcaccaccaccaccaagggggagaacttcaccgaaactgacatcaagataatggagcgagtggtggagcaaatgtgcatcacccagtaccaGAGAGaatcccaggcttattaccaaaggggggcaagtgtgatcctcttttcttcccctcctgtgatcctcctcatctctttcctcatttttctcatagtaggatag

nvCJD and bovine pituitary growth hormone

Jacques Verdrager  10 Jan 98 Lancet
Ghazot and colleagues describe a case of new variant Creutzfeldt-Jakob disease (nvCJD) in a French patient. His illness began in February, 1994 (he died in January, 1996, after his disease had lasted 23 months). In the UK, there has been only one patient in whom clinical onset occurred earlier, in January, 1994.2 The fact that onset in the French case of nvCJD occurred earlier than in all but one of the cases reported in the UK is surprising, even if one considers that France was one of the biggest markets for UK beef. A report for the French National Assembly on the "mad cow" crisis,3 which revealed that the French patient, a mechanic by profession, was also a devoted body-builder, may provide a clue.

Cadaveric human growth hormone has been used to increase muscle strength and reduce fat mass in weight lifters and body-builders. This practice is still going on in some eastern European countries,4 although, apparently, not in France. However, since 1951, a drug well-known in France, "somatotrophine", the bovine equivalent of human growth hormone, has been prescribed for "tissue repairs". In common with human growth hormone, it has a lipolytic and a protein anabolic effect (but has no effect on growth). This drug, reimbursed by the French S╚curit╚ Sociale and administered by subcutaneous or intramuscular injections (100 units daily, for 8 days) was, like most of the other drugs of bovine origin, banned, as a precautionary measure, in July, 1992.

It is possible that the one case of nvCJD reported in France might be an iatrogenic case resulting from the injections of bovine somatotrophin contaminated with bovine spongiform encephalopathy. Onset in February, 1994, is compatible with an inoculation having occurred during the late 1980s (the shortest incubation period with contaminated human growth hormone is 4 years).

1 Chazot G, Broussolle E, Lapras CL, et al. New variant of Creutzfeldt-Jakob disease in a 26-year-old French man. Lancet 1996; 347: 1181. 
2 Cousens SN, Vynnycky E, Zeidler M, et al. Predicting the CJD epidemic in humans. Nature 1997; 385: 197-98. 
3 Guilhem E, Mattei JF. De la "vache folle" ř la "vache ╚missaire". Tome II. Auditions. No 3291. Paris: Assembl╚e Nationale, 1997: 23. 
4 Deyssig R, Frisch H. Self-administration of cadaveric growth hormone in athletes. Lancet 1993; 341: 768-69. 

BSE and Prions: Uncertainties About the Agent

Bruce Chesebro
Humans and domestic animals are tragically susceptible to a family of rare, fatal brain diseases called transmissible spongiform encephalopathies (TSEs) or prion diseases. [HN2], [HN3]A prominent example is the recent epidemic of bovine spongiform encephalopathy (BSE)[HN4] in the United Kingdom. In March 1996, a new variant of a human TSE, Creutzfeldt-Jakob Disease (nvCJD), [HN5], [HN6] was reported in the United Kingdom in a small group of people, all of whom were much younger than most individuals with CJD (1). The unusual nature of these outbreaks prompted ready speculation that the causative agent for BSE was transmitted from cattle to humans, triggering the nvCJD cases. Although no definitive answer to this question has yet been obtained, several recent papers shed new light on this issue.

Brain damage in prion diseases [HN7] is thought to occur when abnormal prion protein (PrP) [HN8] molecules gain access to the brain and cause normal PrPs to take on the abnormal, disease-causing form. Raymond et al. (2) mimicked this process in a test tube and, in their cell-free biochemical system, analyzed interactions between normal and abnormal PrP molecules obtained from various species. Positive interactions between prions from different species, leading to formation of additional abnormal protein, usually predict the susceptibility of the different species to cross-species transmission of the prion diseases. Using abnormal, protease-resistant PrP from cattle with BSE, these workers found positive interactions with normal PrP of cattle, sheep, and mice (all of which are susceptible to experimental BSE), and negative interactions with hamster (which is resistant to BSE). Normal human PrP gave a weak, but detectable, positive interaction, a result that suggests that the biochemical potential for BSE transmission to humans exists, but that humans may be more resistant than other known susceptible species.

Two other groups have focused their efforts on nvCJD to test its possible relation to BSE. Bruce et al. (3) found that when brain tissue from three of the individuals with nvCJD and from BSE-infected cattle was injected into mice, all exhibited the same patterns of lesions in their brain. Furthermore, when brain tissue from eight of the BSE cases and three nvCJD cases (3, 4) was injected into several different mouse strains, all required similar incubation periods before the disease was evident. In a separate communication, Hill et al. observed that the pattern of PrP bands detected by protein immunoblot analysis in mice inoculated with six nvCJD brain extracts was similar to that observed in BSE-inoculated mice (5). These similarities suggest that a similar strain of transmissible agent causes both BSE and nvCJD, but does not provide any indication of how BSE might have been transmitted from cattle to humans.

Prior to the above results, epidemiology had provided the strongest evidence that nvCJD is a form of a human prion disease related to BSE. Although the BSE epidemic itself is well past its peak, it is still uncertain whether the very low number of nvCJD cases detected since the initial report in 1996 reflect the gradual onset of a much larger incidence to be expected in the future. In this regard, data by Cousens et al. recently reveal an increased incidence of CJD in the United Kingdom in certain groups of farm workers exposed to cattle (6). However, these patients did not exhibit the type of plaques typical of the pathology of nvCJD, and the pattern of PrP bands detected was also not the same as that of nvCJD. Thus, this increase in CJD incidence is likely due to factors other than BSE, a conclusion supported by the finding of a similar increase in CJD in dairy farmers in Italy where BSE has not been found.

Although most interesting, these recent findings fall short of proof and illustrate the extreme difficulty of establishing the susceptibility of humans to the BSE agent. The dilemma is accentuated by the fact that the causative agents of all the TSEs remain an enigma. Although the notion that "protein only" can account for the infectious agent has received considerable publicity as a result of the Nobel prize award to S. Prusiner for the discovery of prions, [HN9], [HN10], [HN11] the fact remains that there are no definitive data on the nature of prions. Prions continue to be vaguely defined, and for the most part this term is used as an operational term for the transmissible agent, but without structural implications (7). There are arguments both for and against the hypothesis that abnormal PrP itself is the transmissible agent (see the table below), but on either side of this controversy no argument is as yet completely convincing (8).

The central unresolved issue is the difference between TSEs and nontransmissible amyloid diseases such as Alzheimer's disease, type II diabetes, and amyloidoses [HN12], [HN13], [HN14], associated with various cancers and inflammatory diseases (see table on next page). In both groups of diseases, a normal or mutant precursor protein or peptide is incorporated into an aggregated, noncovalently linked polymeric fibril-like structure (amyloid), often with a high level of b-sheet folding. This ordered aggregate can induce further polymerization of additional precursor protein, thus providing a possible basis for propagation or transmission. Furthermore, in the case of PrP, striking species and TSE strain specificity operates in this induced polymerization process, which might explain the species barrier effects and agent strains in vivo (2, 8, 9). However, none of the non-PrP amyloid diseases has been found to be transmissible by injection or ingestion of the polymers themselves in spite of extensive attempts [see the table above and (10)]. Thus, there is no precedent for the transmission of TSE by the abnormal polymeric PrP. Either we are missing some vital and unique factor that distinguishes the polymers of TSE from those of other amyloid diseases, or the agent of transmission may not be the abnormal polymers themselves.

The alternative is that a virus is the transmissible agent. It is certainly conceivable that a virus might induce polymerization of a normal or mutant cell protein, as has been shown for B19 parvovirus [HN15] and sickle cell hemoglobin (8 , 11). Although no direct evidence for a TSE virus has been obtained, searching for unknown viruses is not straightforward. Even with the powerful methods of molecular biology, without a specific probe or unique sequence, new viruses can be extremely difficult to detect. However, this should not deter future search efforts as new viruses (Borna [HN16] and hepatitis), continue to be discovered.

Support for the protein-only hypothesis also comes from the apparent spontaneous generation of a neurodegenerative disease in transgenic mice that overexpress a mutant form of PrP associated with familial TSE disease in humans (12, 13). These results are inconclusive for several reasons. First, these mice differ from all known TSE models in that no abnormal protease-resistant PrP is detectable in diseased brain tissues by protein immunoblot. Second, brain disease is produced only when the mutant transgene is overexpressed, but not when it is present as a single-copy gene in the normal PrP locus. Third, transmission of this disease occurs only in transgenic mice expressing low levels of the same mutant PrP transgene, and not in normal nontransgenic mice. Thus, "transmission" could be due to transfer of cytokines or other molecules from diseased brain, which up-regulate mutant PrP transgene expression in the recipient mice. Nor have the transmitted materials been shown to have the typical properties of TSE agents, such as unusual resistance to inactivation by heat and harsh chemicals. To explain the lack of transmission to normal mice, it has been proposed that the PrP mutation (Leu102) in the transgene causes a barrier to transmission to normal (Pro102) mice. Although theoretically possible, it is unlikely because effective transmission can occur from humans with Leu102 PrP humans to both monkeys and mice with Pro102 (14, 15).

Hopefully, open-minded future research will resolve the mysteries regarding the nature of the TSE agent. Additional information on this subject must be obtained to better facilitate development of drugs. Evidence suggests that treatment with drugs that interact with the abnormal PrP can prolong survival in experimental mouse or hamster scrapie, a TSE disease originally derived from sheep. Other approaches--gene therapy with TSE-resistant PrP alleles or elimination of the PrP gene itself--are also possible, particularly for domestic animals. Clearly, we are in the very early stages of exploration of this subject. It would be tragic if the recent Nobel Prize award were to lead to complacency regarding the obstacles still remaining. It is not mere detail, but rather the central core of the problem, that remains to be solved.

Commentary

Sat, 3 Jan 1998 -- webmaster
This is more special pleading for viral funding in perpetuity: basically by its nature, virus hunting is so hard and slow that there must be an exception to normal scientific accountability [i.e., research progress].

The issue for me is not so much people's religion on prions but what experiment do they want to do next. To get my attention, the virus camp needs to do more experimenting and less whining. Put some experimental results on the table. But therein seems to lie precisely the difficulty.

It is a somewhat odd format piece in the front unique to Science magazine, what is called 'enhanced,' meaning that there are 9 paragraphs and a couple dozen randomly selected Web links on BSE generalities that could be found in 2 minutes by a Web search (enhanced part).

The odd part is that the two critical tables carry no citations in them whatsoever so it is not possible to independently evaluate the quality of evidence supporting the entries or even know what the author thought were the definitive papers. Peer reviewers obviously need these so evidently there are none for this format.

The lack of dozens of mission-critical citations simply doesn't work for me. The table entry for Alzheimer is simply 'no' -- in view of the well-known cites below, this is completely unsatisfactory -- and this is by no means the worst table entry.

What about:

1. Baker,H.F.; Ridley,R.M.; Duchen,L.W.; Crow,T.J.; Bruton,C.J.
Evidence for the experimental transmission of cerebral beta-amyloidosis to primatesŠ International Journal of Experimental Pathology 1993 Oct; 74(5): 441-54 2. Baker,H.F.; Ridley,R.M.; Duchen,L.W.; Crow,T.J.; Bruton,C.J.
Induction of beta(A4)-Amyloid in Primates by Injection of Alzheimers Disease Brain Homogenate - Comparison with Transmission of Spongiform Encephalopathy
Molecular Neurobiology 1994 Feb; 8(1): 25-39
It is not proven by any means that Alzheimer's is transmissible; however there is the matter of the two abstracts. So you have to point out inadequacies in these papers if you want to go with prion protein-only uniqueness. Maybe there are inadequacies, my point is that inconvenient cites cannot just be ignored.

Then there is transmission of het-S in Podospora anserina from one organism to another. Again, you have to specifically refute PNAS 94: 9773+10012 1997 if you want uniqueness.

Then there is the matter of completely ignoring half of candidate diseases that were listed by Glenner and many subsequent reviewers. Does someone really think that properties of commercial synthetic insulin arise from nucleic acid contamination? Does someone really think they know how late 1997 research into transmission of Parkinson's is going to turn out? -- the Parkinsons's experts don't. Should we be too concerned if Bence-Jones proteins are not transmissible (because the only the donor could possibly express the protein)?

Then there is the matter of the congophilic amyloid diseases for which no transmission is reported under particular sets of experimental conditions. It is exactly these conditions that have to be meticulously reviewed. Maybe some of the experiments from decades back would be done differently today given current knowledge. What exactly was the titre of what was injected, were enriched fractions used, did they try sonicating, what was the lifetime of the recipient species, how long did the experiment run, did they even know what protein they were working with, what was the distance in sequence between donor and host, and so on. Even with TSEs, you could easily get the conditions off and miss transmission and indeed there are many reports of this.

I think a more interesting point is whether protein-only transmission will prove important in other amyloidoses. That is, just because transmission can occur under laboratory conditions, that doesn't imply transmission causes a significant amount -- or any -- of the observed cases. Here is where TSE have a measure of uniqueness so far. Of course, someone could argue that scrapie, kuru, and BSE-nvCJD are highly artefactual situations that never really arose in "nature" and have no real significance in biology as a disease mechanism.

Commentary

Roland Heynkes  5 Jan 97
"Thus, this increase in CJD incidence is likely due to factors other than BSE, a conclusion supported by the finding of a similar increase in CJD in dairy farmers in Italy where BSE has not been found."
Is this increase really [statistically] significant?
"Prions continue to be vaguely defined, and for the most part this term is used as an operational term for the transmissible agent, but without structural implications."
Well said.
"However, none of the non-PrP amyloid diseases has been found to be transmissible by injection or ingestion of the polymers themselves in spite of extensive attempts Thus, there is no precedent for the transmission of TSE by the abnormal polymeric PrP. Either we are missing some vital and unique factor that distinguishes the polymers of TSE from those of other amyloid diseases, or the agent of transmission may not be the abnormal polymers themselves."
Every new finding has no precedent and perhaps we are only missing serious attempts to transmit other amyloid diseases.
"The alternative is that a virus is the transmissible agent. It is certainly conceivable that a virus might induce polymerization of a normal or mutant cell protein, as has been shown for B19 parvovirus [HN15] and sickle cell hemoglobin (8 , 11)."
Of course a virus could induce polymerization, but this is not the problem of the virus hypothesis. Its problem is, that it can not explain, why heterozygotes have so much longer incubation times than codon 129-homozygotic patients and how the site directed mutagenesis could initiate a new inheritable prion disease in mice. I published the whole argumentaion against the virus hypothesis already 1995 and although of course the American author could not know that, it should be able to combine the known published facts by himself.
"Support for the protein-only hypothesis also comes from the apparent spontaneous generation of a neurodegenerative disease in transgenic mice that overexpress a mutant form of PrP associated with familial TSE disease in humans (12, 13). These results are inconclusive for several reasons."
Good trick to attack a weak argument while ignoring the hard arguments. Why should an overexpression of normal prion protein work with the same mechanism as prion protein mutations?
"First, these mice differ from all known TSE models in that no abnormal protease-resistant PrP is detectable in diseased brain tissues by protein immunoblot."
Different variants of CJD have different target cells. A good example is the striking difference between fatal familial insomnia and the CJD variant with the identical pathological mutation. Why shouldn't the overexpression of a normal prion protein allele affect target cells outside the brain, when it causes in skeletal-muscle exclusivelyspontaneous myopathy?
"Second, brain disease is produced only when the mutant transgene is overexpressed, but not when it is present as a single-copy gene in the normal PrP locus."
I can not see any problem for the protein only hypothesis with this.
"Third, transmission of this disease occurs only in transgenic mice expressing low levels of the same mutant PrP transgene, and not in normal nontransgenic mice. Thus, "transmission" could be due to transfer of cytokines or other molecules from diseased brain, which up-regulate mutant PrP transgene expression in the recipient mice."
Could different [degrees of] homologies between infecting and host prion proteins be a simpler explanation?
"Nor have the transmitted materials been shown to have the typical properties of TSE agents, such as unusual resistance to inactivation by heat and harsh chemicals."
Why should overexpressed normal prion protein be resistant against heat and harsh chemicals. I would not expect this.
"To explain the lack of transmission to normal mice, it has been proposed that the PrP mutation (Leu102) in the transgene causes a barrier to transmission to normal (Pro102) mice. Although theoretically possible, it is unlikely because effective transmission can occur from humans with Leu102 PrP humans to both monkeys and mice with Pro102 (14, 15)."
A reasonable argument, but CJD is not exactly the same as a prion disease that is caused only by an overexpression of normal prion protein in mice.

Prion oligomer -- review of literature

Roland Heynkes 6 Jan 98
The tertiary structure model for PrPc reveals hydrophobic faces that could be involved in dimer formation [Huang, Z., Gabriel, J.-M., Baldwin, M. A., Fletterick, R. J., Prusiner, S. B., and Cohen, F. E. (1994) Proc. Natl. Acad. Sci. U. S. A. 91,7139-7143 and Warwicker,J.; Gane,P.J. - A model for prion protein dimerization based on alpha-helical packing - Biochemical and Biophysical Research Communications 1996; 226(N3): 777-82].

But it forms heterodimers with a protein named Bcl-2 [Kurschner,C.; Morgan,J.I. - Analysis of interaction sites in homomeric and heteromeric complexes containing bcl-2 family members and the cellular prion protein - Molecular Brain Research 1996; 37(N1-2): 249-58].

Homodimers of prion protein have been found in transgene mice and infected sheep, but not in healthy sheep [Priola,S.A.; Caughey,B.; Wehrly,K.; Chesebro,B. - A 60-kDa prion protein (PrP) with properties of both the normal and scrapie-associated forms of PrP - Journal of Biological Chemistry 1995 Feb 17; 270(7): 3299-3305].

Coworkers of Prusiner unsuccesfully tried to find dimers with normal prion protein, but they were also unsucessful with there attempt to convert the normal prion protein [Rţber,A.J.; Borchelt,D.R.; Scott,M.; Prusiner,S.B. - Attempts to convert the cellular prion protein into the scrapie isoform in cell-free systems - Journal of Virology 1992 Oct; 66(10): 6155-63], which has been done by Kocisko et al later on. So it may be that the normal prion protein forms dimers on the cell surface.

I found the time to read an old, but perhaps still interesting article about transmission of CJD to mice:

Transmission of Creutzfeldt-Jakob disease from human blood and urine into mice 
Tateishi,J  The Lancet 1985 Nov 9; 2(8463): 1074.
Summary: brain infected 7 of 10 mice, cornea 1 of 6, whole blood 2 of 13, and, remarkable, urine infected 5 of 10 mice. The pattern of lesions was independently from the tissue used: always the same in the mice and the CJD patient.

GPI proteins can serve as viral receptors

8 Jan 98 webmaster 
It is quite possible that prion protein could be a viral receptor for one or more viruses, yet these could have nothing whatsoever to do with prion disease. that is, every protein on the cell surface is potentially used by some virus or another and there are a lot of viruses out there.

Viral receptors need not be integral membrane proteins. for example, CD46 as a GPI protein used by measles virus. [J Virol 1994 Dec;68(12):7891-7899 ].

Decay-accelerating factor (CD55) is another GPI surface protein serving as echovirus 7 (picornavirus family) receptor. [PNAS 1994 Jun 21;91(13):6245-6249]

HYPOTHESIS

 Jan 10, 1998 Lancet  S W Davies and others
Are neuronal intranuclear inclusions the common neuropathology of triplet-repeat disorders with polyglutamine-repeat expansions?

Mad Cow Home ... Best Links ... Search this site