Prion Exon Data Archive
Mad Cow Home ... Best Links ... Search this site

SP-1 sites; AP-1 sites, Ap-2 sites; motifs 1-4; CCATT sites; exon 1 start

>rat  D50092 http://www.ncbi.nlm.nih.gov/htbin-post/Entrez/query?form=6&dopt=g&db=n&uid=01235732
tcttcctctttaccaatttcttgttaccaaagttccacgatggcctttttctttccgttaggtaacctttcattttctcgactacccattatgtaacgggagcgctgggttctggatcagtcttccattaaagatgacttttatagtctgtgagcgtcgtcacagagtgctgacactggggtggggaggggagtacggggggagggggttaaacagataacaagcatttaagccagtacggagcggtgactcatcccaccgcgagaagccattggtgagcatcacgctccgcccctcgccccgcccagcccccggcctgtcgggtccctcaccacgccccgctcccccgcgttgtcagagcagcagacggagtctgagtctgagcgtcgcg-----tcggtggcag

>mouse2 U29186 Lee http://www.ncbi.nlm.nih.gov/htbin-post/Entrez/query?form=6&dopt=g&db=n&uid=02865214
tcttcgttaccaatttcttgttaccaaagttcaacgatggcttcctcgctccgttaggtaacctttcattttctcaactacccattatgtaacgggagcattgggtactggatcagtcttccattaaagatgatttttatagttgctgagcgtcgtcagggagtgctgacactgggggcggtttaaacagatacaagcatttaagccagtccggagcggtgactcattcccccaccccccacccccccgcgagagacgcggcgcggccattggtgagcatcacgccccgcccctcgcccagcctagctcccgcctgccccgcccctttccactcccggctcccccgcgttgtcggatcagcagaccgattctgggcgctgcgtccgatcggtggcag

>hamster M14055 Basler http://www.ncbi.nlm.nih.gov/htbin-post/Entrez/query?form=6&dopt=g&db=n&uid=00191424
tctccctctttagcaatttcttgctcctagagtttcagcaattgctttctcgctccattaggcaacctttcattttctcaccttccccattatgtaacgggagcaatgggttctggaccagtcttccattaaagatgatttttatagtcggtgagcgccgtcagggagtgatgacacctgggggcggtttaaaccgtacaatcccttaaaccagtctggagcggtgactcatggcgcggccattggtgagcacgacgcaagccccgccccacccagcccggccccgccctgctacccctcctgactcactgccccgcccgctcccccgcggcgtccgagcagcagaccgagaaggcacatcgagtccactcgtcgcgtcggtggcag

>human U29185 Lee http://www.ncbi.nlm.nih.gov/htbin-post/Entrez/query?form=6&dopt=g&db=n&uid=02865216
tctcctctttagaaatttctggttgccaaagttccagaaattgcttcctcattcctgagcctttcattttctcgatttctccattatgtaacggggagctggagctttgggccgaatttccaattaaagatgatttttacagtcaatgagccacgtcagggagcgatggcacccgcaggcggtatcaactgatgcaagtgttcaagcgaatctcaactcgttttttccggtgactcattcccggccctgcttggcagcgctgcaccctttaacttaaacctcggccggccgcccgccgggggcacagagtgtgcgccgggccgcgcggcaattggtccccgcgccgacctccgcccgcgagcgccgccgcttcccttccccgccccgcgtccctccccctcggccccgc

>sheep1 U67922=X79914 Lee http://www.ncbi.nlm.nih.gov/htbin-post/Entrez/query?form=6&dopt=g&db=n&uid=01778172
tgtccttttcagaaatttctggttaccagagttcccgaaattgctttctcattccctaatctttcattttctccattacgtaacgagaagctggggctttggccgattttccctctaaagatgatttttatcgtcaacaagcaatttcagggagtgatgagccagggaggcggtgttagttgatgctagcgtttatgctagtctcaactcgtttttcccagggacttagattcctgggtctgccggtaaaccccgggcgcccgcagcgggcgcgcctgagcgtgcgcgcgccgtcgcctccccccccccgcagctcctcctctgcacggcgactcaccagccctagttgccagtcgctgacagccgcagagctgagagcgtcttctctcccagaggcaggt

>cow D26150 Yoshimoto http://www.ncbi.nlm.nih.gov/htbin-post/Entrez/query?form=6&dopt=g&db=n&uid=00442463
tgtcccttttagaaatttctggttaccaaagttccagaaattgctttctcattccctaatctttcattttctccattacgtaacgagaagctggggctttggccgattttccctttaaagatgatttttatcgtcaacaagcaatttcagggagtgatgagccggggaggcggtattagctgatgctagcgtttaagctagtctcaactcgtttttcccagggacttagattcctgggtctgccagtaaaccccgggcgccggcagcgggtgcgcctgagcgtcgcgcgcgccgtcgcctccccgcccctgcccctcctcctccgcccggcgacttacccgccctagttgccagtcgctgacagccgcagagctgagagcgtcttctctctcgcagaagca



>mouse1 X79932 Saeki http://www.ncbi.nlm.nih.gov/htbin-post/Entrez/query?form=6&dopt=g&db=n&uid=00517361
cttcctcgctccgttaggtaacctttcattttctcaactacccattatgtaacgggagcattgggtactggatcagtcttccattaaagatgatttttatagttgctgagcgtcgtcagggagtgctgacactgggggcggtttaaacagatacaagcatttaagccagtccggagcggtgactcattccccccaccccccacccccccgcgagagacgcggcgcggccattggtgagcatcacgccccgcccctcgcccagcctagctcccgcctgccccgcccctttccactcccggctcccccgcgttgtcggatcagcagaccgattct

>mouse3 U52821 Baybutt http://www.ncbi.nlm.nih.gov/htbin-post/Entrez/query?form=6&dopt=g&db=n&uid=01297087
aatgtcgaaaatcttcgttaccaatttcttgttaccaaagttcaacgatggcttcctcgctccgttaggtaacctttcattttctcaactacccattatgtaacgggagcattgggtactggatcagtcttccattaaagatgatttttatagttgctgagcgtcgtcagggagtgctgacactgggggcggtttaaacagatacaagcatttaagccagtccggagcggtgactcatccccccccacccccacccccccgcgagagacgcggcgcggccattggtgagcatcacgccccgcccctcgccccgcctagctcccgcctgccccgcccctttccactcccggctcccccgcgttgtcggatcagcagaccgattct


>ra tcttcct-ctttaccaatttcttgttaccaaagttccacga-tggcctttttctttccgttaggtaacctttcattttctc 
>mo tcttc--g-tt-accaatttcttgttaccaaagttcaacga--tggcttcctcgctccgttaggtaacctttcattttctc 
>ha tctccctgctttac-aatttcttgctcctagagtttca-gcaattgctttctcgctccattaggcaacctttcattttctc
>hu tctcct--ctttagaaatttctggttgccaaagttcca-gaaattgcttcctcattcc-t--g--agcctttcattttctc 
>sh tgtcctt--ttcagaaatttctggttaccagagttccc-gaaattgctttctcattccct-----aatctttcattttctc
>co tgtccct--tttagaaatttctggttaccaaagttcca-gaaattgctttctcattccct-----aatctttcattttctc
....o.o.o....oo.o..ooooooo.o:o.o:o.oooo:o:.o:..:..ooo..oo..ooo.o.....o:.ooooooooooooo


>ra ctttcattttctcgacta-cccattatgtaacgg-gagcgctgggttctggatcagtcttccattaaagatgacttttatagtctgtgagcgtcgtcacagagt
>mo ctttcattttctcaacta-cccattatgtaacgg-gagcattgggtactggatcagtcttccattaaagatgatttttatagttgctgagcgtcgtcagggagt
>ha ctttcattttctcaccttccccattatgtaacgg-gagcaatgggttctggaccagtcttccattaaagatgatttttatagtcggtgagcgccgtcagggagt
>hu ctttcattttctcgatttctccattatgtaacggggagctggagctttgggccgaatttccaattaaagatgatttttacagtcaatgagccacgtcagggagc
>sh ctttcattttct--------ccattacgtaacgagaagctggggcttt-ggccgattttccctctaaagatgatttttatcgtcaacaagcaatttcagggagt
>co ctttcattttct--------ccattacgtaacgagaagctggggcttt-ggccgattttccctttaaagatgatttttatcgtcaacaagcaatttcagggagt

>ra tcacagagtgctgacac-tggggtggggaggggagtacggggggagggggttaaacagataacaagcatttaagccagtacggagcggtgactca
>mo tcagggagtgctgacac-tgggggcggt-----------------------ttaaacagatacaagcatttaagccagtccggagcggtgactca
>hu tcagggagcgatggcacccgcaggcggt-------------atcaactgatgcaagtgttcaagcgaatctcaactcgttttttccggtgactca
>sh tcagggagtgatgagccagggaggcggt-------------gttagttgatgctagcgtttatgctagtctcaactcgtttttcccagggactta
>co tcagggagtgatgagccggggaggcggt-------------attagctgatgctagcgtttaagctagtctcaactcgtttttcccagggactta

>ra gtgactcat---cccacc------------gcgagaa----------gccattggtgagca----tcacgctccgcccctc--------gccccgcccagcccccgg-cctgtcgggtccctcaccacgcccc------------gctccccc_gcgttgtcagagcagcagacggagtctgag----------------cgtcgcgtcggtggcag
>mo gtgactcattcccccaccccccacccccccgcgagagacgcggcgcggccattggtgagca----tcacgccccgcccctc--------gcccagcctagct-cccg-cct------------gccccgcccctttccactcccggctccccc_gcgttgtcggatcagcagaccgattctgggcg-----------ctgcgtcgcatcggtggcag
>ha gtgactcat--------------------------------ggcgcggccattggtgagcacgacgcaagccccgccccacccagcccggccccgccctgctacccctcctgactca----ctgccccgcccg-------------ctccccc_gcggcgtccgagcagcagaccgag--aaggcacatcgagtccact-cgtcgcgtcggtggcag
>hu gtgactca--ttcccggccctgc--ttggc-agcgctgcaccctttaacttaaacctcggccggccgcccgccgggggcacagagtgtgcgccgggccgcgcggcaattggtccccgcgccgacctccgcccgcgagcg_ccgccgcttcccttccccgccccgcccgcgtccctccccctcggccccgcgcgtcgcctgtcctccga------_gccagtcgctgacagccgcggcgccgcgagcttcc
>sh gggacttagattcctgggtctgccggtaaaccccgggcgcccgcagcgggcgcgcctgagcgt-----------------------------------gcgcgcgccgt--------cgcc--tccccccccccgcagctcctcctctgcacggcgactcaccagc-----------------------------------cct------_agttgccagtcgctgacagccgcagagctgagagcgtct
>co gggacttagattcctgggtctgccagtaaaccccgggcgccggcagcgggtgcgcctgagcgt----------------------------------cgcgcgcgccgt--------cgcc--tccccgcccctgcccctcctcctccgcccggcgacttacccgccct-----------------------------------------_agttgccagtcgctgacagccgcagagctgagagcgtct

exon 1
gcgttgtcagagcagcagacggagtctgag----------------cgtcgcgtcggtggcag  gtaagcgggctgctgaagcc  D50092  Rattus norvegicus Saeki,K 1997
gcgttgtcggatcagcagaccgattctgggcg-----------ctgcgtcgcatcggtggcag  gtaagcgggctgctgaagcc  U29186  Mus musculus Lee,I.Y 1998
gcggcgtccgagcagcagaccgag--aaggcacatcgagtccact-cgtcgcgtcggtggcag  gtaagcgg-cttctgaaggt  M14055  Mesocricetus auratus Basler,K 1987

------gccagtcgctgacagccgcggcgccgcgagcttctcctctcctcacgaccgaggcag  gtaaac-gcccggggtggga  U29185  Homo sapiens Lee,IY 1998
ctagttgccagtcgctgacagccgcagagctgagagcgtcttctctcc------cagaggcag  gtaaatagccacgtagtcct  U67922  Ovis aries Lee,IY 1998
--agttgccagtcgctgacagccgcagagctgagagcgtcttctctc-t--cg-cagaagcag  gtaaatagccgcgtagtcct  D26150  Bos taurus Yoshimoto,J 1994

exon1b
>hu gtaaac-gcccggggtgggaggaacgcgggcgggggcaggggagagcgc
>co gtaaatagccgcgtagtcctttaaactcccagcggaggacgccaaccctgggtcttgcggccgaggccc-aggg-acccagccgaatcggattgg-tgggaggcagaccttgacc_gtgagtagggctgggggcttgcggcgggcgcggggaacgtcgggcctgttg
>sh gtaaatagccacgtagtcctttaaacccccagcggaggccgcc---cccgg--cttgcggccgaggccctagggcactcagccggatcggactggctgggaggcagaccttgacc_gtgaggaggactgggggcttccggcgggcgcggggaacgtcgggcctgttt
--


>ra	2832	2878	5109	5206
>mo	8612	8658	10849	10946	28680	30687
>ha	333	342	349	351	354	410
>hu	12634	12767	15390	15488	25464	27817)
>sh	5666	5717	8139	8236	22268	26295
>co		803	855		3298	3395

	exon 1	intron 1	exon 2

>rat	47	2230	98  83% identical to mouse over intron 1
>mouse	47	2190	98  539 bp in 3 retrotransposons in intron 1
>hamster	57	-	98
>human	134	2622	99  only last 180 bp related to cow in intron 1, 353 bp in 3 retrotransposons
>sheep	52	2421	98  91% identical to cow over intron 1
>cow	53	2442	98

Though the prion gene is chock-full of retrotransposons, there are no recognizable ones here except for 3 each in human  and mouse intron 1: 

>mouse intervening repeats in region of exon 1-2
     repeat_region   7980..8069 PB1D7 
     exon 1             8612..8658
     repeat_region    9619..9844 B3 = 226 bp
     repeat_region    10044..10163 B1-F = 120 bp
     repeat_region    10070..10163 PB1D7 = 193 bp
     exon 2           10849..10946

>human intervening repeats in region of exon 1-2 
     repeat_region   11478..11800 AluJo
     exon 1          12634..12767
     repeat_region   14413..14498 L1MC1  = 86 bp
     repeat_region   14583..14653 MIR    = 71 bp
     repeat_region   14752..14947 L1ME3 = 196 bp
     exon 2          15390..15488

>sheep intervening repeats in region of exon 1-2
     repeat_region    3756..4215 MLT1F
     exon 1           5666..5717
     exon 2           8139..8236
 
>ra intron 1
gt2881 aagcgggctg ctgaagccag gcgtcagcga gcattcagcc ttcctcccgt cgacaagctc
     2941 ggcttactgt gcctctccgg gacttgaggc cgcggggctg ggactggggt tgagcttggc
     3001 taggaggtgg ctgtgcaccc gctgtgcgcg actcctggag ggaccgaatc ccagggcagc
     3061 gaggccggga gccgagcctg attcacagct caacatcgct gtgggggatg gggggttggg
     3121 ggggtggcat cttttaactg ccctgtgctg ttttcttctc tcgttgtaat agctacagcg
     3181 aacataattt caccccgtga ttccaccacg gtctcatccg tcctcagcac cacactcatt
     3241 gctccccttg ctcagtttca tactcagcgc agccgttcgc cttcactgcc ctgcctaggc
     3301 gttttcatgg ttgtcttata ttcttttact ttgaatatcg tggtttaata gcagttgccg
     3361 gtgtgctaaa ttcctcattt ccttaagaga aactcctggg aggatggaat taaagacgtt
     3421 gcaaatttaa ttataccaca aacaggaatc aaaattttgc attaaaatgc cagacatctt
     3481 gaaaaattta actattcaat aaaaaaaaaa aaggaactac tttacctaca cacacatccg
     3541 agtgcttcaa agagtccaag gaaatagaaa gctaagggat gatttgggtt gtatttgaat
     3601 ctgacacgag ctttccatat tatttatagc agggactgaa ggatgagtca ttttctgaat
     3661 aagatgcaaa ttaaagcaag tttgttgtct ttacatcgat taaacagaca gagatgatga
     3721 cagcagcaac cctaacctag aggttgtctg aaaccaccgt gttcaagttt ggggagcagg
     3781 tggccctcct taagagctcg attgattgct ttacaaccaa cgttatgact tggcattgcc
     3841 tggggttcct tttatttatt cctttcttta aaagactact atctatttta tgagcatgag
     3901 tgtttcgctc cacagaagca tgtatacaag cctggttctg cggaggtcag aagagacagg
     3961 gtgttggaag ccctggaact agagctaggg atgattctgt gagcccctgc cacaggggag
     4021 ctcagatccc caatccaggc tgtctggaag agcagccaga gctcttaact accgaacacc
     4081 ccccccccca tcccctctca ttcacattta gaaaggagaa aactgctacc catgtctggc
     4141 atttatttca gagattaact gtgcaaaact cgatgtgaaa gtatactatt ctgtttccca
     4201 gtcacactta gttgacagtg taagtcagta agggctttgg ttggttggtt tggttggttg
     4261 gttcctgggt tagtctggat gtgcttgttg agagctcaat aacaggcttt caatatggat
     4321 atgtagctgg gaattcgcta tgtagaccag gcaggcctca aatttgtggc aatcctccct
     4381 gtgattcccc agaatgccct ggtacaggca taagccactg tgcccagccg taaaacaatc
     4441 tggtgaggta ttattagttg catgctgtga cccagaaacc ccacttctgg caattcacct
     4501 gccgtggtgg aaccaacaaa gggctagggg agccatatgg ccaacagtta cagaaaatta
     4561 gatccaaggg aaaagcaacc taaatgttta acaggcgagc agctaagaaa ctgacaggct
     4621 cgtgagggag ctgtagcaat cccgaagaac actcttcatt ttagactcca tgtatccctg
     4681 ggaaaaacag agtcaaagta caggttagga gaccgggact cctctggacc catgctgtcc
     4741 tctgaaaagc ccagaagagc tataatgaaa gagctcagaa gatgtctgat cttggctttc
     4801 tttatgtttg ttgctgtatt gtttccacta acaaacaact aaaaaaaaaa aaaaagttca
     4861 caggcttctt tccttaaaat actggggatt gaacccaggg atagtttttt agtgtctaaa
     4921 ttaacatgac catgccctgt ttgccttttt ggagtatgtt tgaatctgcc cttatttcca
     4981 ttctcaaata ctgctccatt ttatatgact atttagtttt ggcttgataa tttgcatatg
     5041 agattagatc atctttcagt tctcagactt atttatcaat tctagttttt ctttttgttg
     5101 ttttaaag

>mou intron 1
gt aagcgggctg ctgaagccag gccttggcga gcactcagcc
     8701 ttccgtcgtc aagctcggct cactgcgcct ctcggggcct tgaggccacg gggactagga
     8761 ctgggactgg gactggggct gagtctggct gggaggtgac tgtacacccc ctgtgcgcga
     8821 ctcctggagg aaccgaatcc cagggcagcc aggccgggag ccagcctttc cttcccgagc
     8881 cagattcaca gctcagcatc gctggggatg ggggtggcat cttttgactg tccttggctg
     8941 ttttcttctc tctttgtagt agctacagcg aacataattt tacctcgtta ttccaccaca
     9001 gtcattactc ccttgcacag tttcattctc aacgtcgccg tgcgccttca ctgccctgtc
     9061 taggcgtttt catgattgtc tattttcttg tactttgaat accgtggttt aatagcagtt
     9121 gcgggtgcgc agaattctcc atttccttaa gagaaactcc tgggagaatg ggactaaaga
     9181 cgtgcaaatt taattatatc gcaaacagga atcaaaattt tgcattaaaa tgccaaacat
     9241 cttgaaaaat taactattca atgaagaaaa ggaactactt tacctacaca cacatccgag
     9301 agcttcgagg aggcgaagga aatagaaagc taagggatga tttgggttgt atttgaatct
     9361 gacacaagct ttccatatta tttatagcag ggactaaacg atgagtcatt ttctgaataa
     9421 gatgcaaatt aaagcaagtt tgtttgttgt ctttacatct attaaataga cagagacaat
     9481 ggcaacagca accctaacct agaggttgcc tgaaagtgtc aggtttggga acaagtggcc
     9541 ctgcttaagg gctagaaaga ttgctttaca accaacaatc atgacttgac attgcctggg
     9601 gttccttttg tctattcctt ttttaaaaga ctagtgttta ttttatgtgc atgagtgttt
     9661 tgcatccaca ttcgcctgta tacacacctg gttctgtgga ggtcaggaga gggtgctgga
     9721 tgccctggca ctagagccgt gaatggttat gtgagcccct gccacagggg agctcagaac
     9781 caaatccagg tcctctggaa gagcaaccag agctcttaaa acttctaagt atccctccat
     9841 cccctttcca tcatatttgg aaaggagaaa actgctaccc atgcctggca tttatttcag
     9901 agattaactg tctgtgtaaa acttgacatt gaaagtgcac tattctgttt cccattcata
     9961 cttagttgag actactgtaa gtcagttagg gctttttttg tttggttcct tggttagttt
    10021 ggagtgtgtt tgtgagctca ttaacaggct ttcagtatgt agctgaaatt tgctgtgtag
    10081 accagacagg cctcaaattt gtggcaatcc tccctgcatc ttcccagaat gccctggtac
    10141 aggcataaac caccgtgccc agcagtaaaa caatctggtg aggtattatt agtcgtgtgc
    10201 tgtgacccag aaaccccact cctggcaatt tactgggaag gaacaaacaa agggctaggg
    10261 gagccatatg gcctgcagtt agagaaaatt agatccaact gaaaaatcaa cctaaaggtg
    10321 taaaagccaa gcagttaaga aactgacagg ctcatgatgg aagccgaggc catcgtgaac
    10381 actcttcatt ttaggcccca cgtatcactg gggacaactg agagtcaaag tacaggtaag
    10441 gagaccaagg cttttcagga ctcaggctgt ctcagtgaaa agcccagaag agcagtaatt
    10501 gaaagagctc agacgatgtg tctgatctcc tctgtttgtt tgttgctgta ttatttccac
    10561 taacttattt gggaggaaaa aaaacagttc acaggcttct tttcttgaaa tactggggat
    10621 tgctgggatc gaacccaggg ataggttttt agtttctaaa ataacataga tcatgccctg
    10681 tttgcttttt ggaatatgtt tgcgctgccc ttattttcat gttcaaatac tgctccattt
    10741 tgcgtgactc tttagtattg gtttgatgat ttgcatatta gattagattg tatttcagtt
    10801 ctcagactta tttatcaatt ctagttttct ctttttgttg ttttaaag

>ha partial intron 1
gtaagcggct
      421 tctgaagcct ggccccggga agggtgctgg agccaggcct cggtaagcct tcggcttccc
      481 agagccaagc ccggcttact ccggctctcg gggcgctgag gccgcggggc tgaggttgag
      541 tctggctggg aggtgaccgc gcacccgcag ccgcgcgtct ccttgaggga ccgaacccca
      601 ggagaggcca ggagccatcc cttcctcccg agcccggctc acccccagag tcgctcgggg
      661 atgggggatg ggggatgggg tggcatcttt tgactgtcgt ttgctgtttt cttctctctt
      721 tgtaatagct acagcgaaca taattttacc cagggttcca ccgtggtctc gtccgtcctc
      781 ggcatctctc agtccagtac atacccaagg 

>hu intron 1
ccc cctcggcccc gcgcgtcgcc tgtcctccga gccagtcgct
    12721 gacagccgcg gcgccgcgag cttctcctct cctcacgacc gaggcaggta aacgcccggg
    12781 gtgggaggaa cgcgggcggg ggcaggggag ccgcgggggc cgagtgagga ccccgggcct
    12841 cgggtcccag gcgcaagggt gcccggccgg gcggggtcgg gaccccagtg aggaggggcc
    12901 gggggctgcc ccgcgggcgc gtgacggtct cgggcctgcc cggctgcgct ggtctccgct
    12961 cgggtgaggc ggcttggctt cgcttttcag gttaggaaag ctccctttac tgcgcgttgg
    13021 ggggctgggg gagctggcgg agccacgtta gggaggtcgg tggcgccggg gtgtctcagc
    13081 gccccctgca ccccgcgcgg gtccggccca gcgggcgatc gctggcgccc agggaactcc
    13141 gggagggccg ccagcgggct ccgcaggcgc ggggcgggga ggggcgcctg ggggccgcgg
    13201 ggctcgcgct ccccgcccgt tggccgcccc tcggaggccg agatcggggc ccagaacgcc
    13261 ccttggcaaa gcctggcgct tccgcgatgc ccagagggtg cttgggggga tggagagagg
    13321 ggcgcccgcc ggggtagttc cgggagcctc ggtgcctccc gccgcagctg cagcgttcct
    13381 cccgggaggc ggcccagccc ttcatcctcg ccgcctgagc ttctccgagg ggggctgcag
    13441 ccttgcggcc gttgccaccg cctggagaag cggcccacgc ggactgacgg gcgggggcgg
    13501 ggcctcgggc ctcggcgggg gcggggtccg gggaggcccc accctctgtt ctccaggggc
    13561 ggggagagag gagctgcagg tctgcggcct ggccccaggt gcgatggcgg accccagctt
    13621 ggccagtcac attcctccca gtccccctgg agggagaacg ctggccatgg ggggctccaa
    13681 ggaacaacca gcctcggatg acgacccttg ggtcaccggt ctccccacct gtgcggcagg
    13741 cgccttcacg tttcattatt aaacaatggg gagaaatcca tgtttactgt cctttttagg
    13801 aattttttgc tcttctcttt gaggtggctg taggaaatag attttttttt taacctcgca
    13861 attccaccac ggtcacatcc atcctcgcca tcgcagagcc acagctctcc gtttttgttt
    13921 cctagcctcc agattctcac acaacacagt gcagtttcac tgctgtaatg atgaggatct
    13981 tcatggccgc gttattttct tgttctgaga gcatcacggt ttaattagca gttccccata
    14041 tgatttgaag tgtttcccgt ttccttaggg aaaactcctg gtagaatagg attaaggatt
    14101 tttacaaata taattatcaa aaacatagga acagggaatt ggataaatat gttaaacttc
    14161 tggaaaaatc aacaacgctc ttagatttgt agaagaaagg aaaaaatcac cagtggaaag
    14221 gagcaatttt acttacacaa acacagagaa ggtcttacag tgaaaaaaag ctaaccagta
    14281 aggggaaaag caggcagagg ggtaggatgt gatttgtatg ttatttatat ctaacacaag
    14341 tcttccacac cgaaaggaaa atattaagat tataatagat aaatggcaaa atgatgagtc
    14401 atttacacaa taaaatgcaa attagagcat gtttgggtta tcattttaca tctattaaaa
    14461 taaccaaaat aattaatagt aacagcaacc cttgctggaa ggttgcccaa aacttggcat
    14521 tttcaagtgt ctggggaggt ggcagggctt tggggtcaca aagatggttc tgcagtcaat
    14581 tttgtgacct tggacaggct acctaatttc ctgatcctcc ttttgtccat tcatagaatg
    14641 gaggaaatga tagctacttt ctgcgtctgt atgtatgagt tattgggggc atttcgaacc
    14701 agtgacaaac attttgttaa gcaatctggt gatgcattaa gaagctggaa gctgtgaccc
    14761 agaaacccca ctcctgagaa cttacctgca atggaagaaa caaacaaaca aaaacaggca
    14821 tgtattccta gcagaatgat ctaaaattag aacacctgga aaagagccta aatgtataac
    14881 accagggcag tagctaagaa aattatgaca cattaactga aatgaacatt atgtaaccac
    14941 taaaaatcat gattttggag cctgtgatat gtggggaaaa actgacaagt aaaaaagtgg
    15001 gttattaact gcacctgctt actctaacgt gaacgcatat gtgaaaaatc tgaaaggaaa
    15061 agcacagaaa atggacgttt tcattgaaat tgtcggtgat cttaattttc ctttggtgaa
    15121 tatattgctc tcactaaggg cgtttaaaaa atagttcaca ggttttaatt ttttagatga
    15181 aatggaccca cagttttctg taagagaaag gagagattgt tatatttgct acttagaata
    15241 aaagattttt agccaacgtt gtttcctttt tcaaatattt ttccattttt ttagttgatt
    15301 aatgatttag taatttgtgt attgggtttt tttaagaatc agttcttaga ttcatttatc
    15361 aattctagtt ttttgttgtt gtttttaag

>cow intron 1
gtaaa tagccgcgta gtcctttaaa ctcccagcgg aggacgccaa
      901 ccctgggtct tgcggccgag gcccagggac ccagccgaat cggattggtg ggaggcagac
      961 cttgaccgtg agtagggctg ggggcttgcg gcgggcgcgg ggaacgtcgg gcctgttgag
     1021 cgtgctcgtt ggtttttgcc agccgccgct cggttttacc ctcctggtta ggagagctcc
     1081 atttactcgg aatgtgggcg ggggccgcgg ctggctggtc cccctcccga ggtatgtggg
     1141 tggtgtgtag gaatctagcc ccctcccacg ctcgtccact gcgggagtgg gatgggcgaa
     1201 tcgcaccggt agaggggccg cagtcgagga accgctgggg acctcagaag aacaagggcg
     1261 agcccgggat ttgggccctc ccgaagccca gaggagtcgc ggaattgggg gtgggggtgg
     1321 tggggaagaa acgggcgcca acggggcccg acctcggcgg tgaggagtgc cggagcatcc
     1381 gtgggccccc agccgctgct gccgaactcc tcccgagagg cggccctgcc tgccatcacg
     1441 cggctgggag gtacctgggt agccgcagcg ggtgggtctc tggcaacccc ccggggatcg
     1501 gctctggcgg gcgtacgtgg cctgggcttc agcctcggcg cggggaatca tgggccacct
     1561 ggcgctctct ccgggccaga gaaatccagg taccgggaac agtgtttcct gggagctctg
     1621 atgtggtgga cccaaaagca aagcgaaatt ttccctgtct cgactgatcc tccagaagga
     1681 gggaactcgg ccgtcaggag actgagggga ggggattcag gcgcctctca gagaaccacc
     1741 ctcatctgcc agtaagggtg gcaccttcac gcttgatttt tttttttttt tcccctcaca
     1801 cgtttgatta ttaaacaacg agaagtccgt tttttgctgt cctttttcgt ttttgttttt
     1861 tttttttcct tttcttttgg taccatatgt agcaaataga ttttttaaaa tcataagccc
     1921 accaccctca ccatcttttt ttcagtttcc tcgtctccag attcttaaca acaaagcagt
     1981 ttcacctccc tgatcatggt tatccttatc tcatggccgg gttattttct tgtacttaag
     2041 agcaatcacg ttttattaag cagttccccg aatgctgaac ctttgaagtg ttacctttcc
     2101 ttacaaaaga taccacatag aataggatta aaaattttca caagttgtca gagaaaaata
     2161 ggaacagaaa attgtataaa aatgtcagac ctctggaaaa tgaacagctc tctcagattt
     2221 gaaaattaac ctatgaaaag gaacagtttt cctacggaaa cattgaggtg ctctaacaat
     2281 gaaaaagaat cagaaaagga aaaaaacaga gttaggatgt gatttgtata tgatttgtat
     2341 ctgatgcaaa tttttcatac ttgtgaaaga aaaatatcaa gattataaaa agataaatgg
     2401 tgaaatgaac aatcatttat gaaataaaat acaaatcaaa gcaagtctgg atttacaact
     2461 actagtaaaa acaacagtaa cagcaaccac ttctggaaag ttacctagaa atttgcatat
     2521 tcagtatgtg aggtggcaag gctttggagt tagaaatatg gtctgcaact aattttacaa
     2581 tttgggacct aatttcctca tccccctttt ggacattcat aaaatagagg aaattatacc
     2641 tacttcagag tttgccaaga ttaactgtgt aaaactgacc tttagtgtgt atacttttat
     2701 tcttttccta gtcacactgc actgggggac gttgtgaatc tgtatgaaat ttgtgaaaaa
     2761 cagtcaggtg atcctttaag ccatgaccct aaaacccact cctgggaact tacctgtaat
     2821 ggaggaaacc aggaaagaag aagaaaagct gcattcaccc acagaactca gaatgatcta
     2881 aaattagatc cagtccggag tcaacctaaa tgtattaata aaatagcagg gcagcagcta
     2941 agaaaatcat agcactttaa ctgaaaggaa cattgtgtaa ccatcacgag tcataatttt
     3001 agagcctctc tgtgatatac aggaaaaaac tgacaggtca aagtaagatt actcagacat
     3061 ggatgcgttt gtggaaaatc tgaatgaaaa atgaatccac agtttgctgt gtatgggagg
     3121 agagttcagt gtcacgtttg ctgctttttt taagttagca tcatctcttt tttaaaaata
     3181 ctatcatatt ttttccctga gtagattcat tagtggttta ataatttata tactgttatt
     3241 ctgttaaata atccgttctt agatttatca attatagttt tttctttttt ttttaag

>sheep intron 1
gta aatagccacg tagtccttta aacccccagc ggaggccgcc
     5761 cccggcttgc ggccgaggcc ctagggcact cagccggatc ggactggctg ggaggcagac
     5821 cttgaccgtg aggaggactg ggggcttccg gcgggcgcgg ggaacgtcgg gcctgtttag
     5881 cgtgctcgtt ggtttttgcc agccaccgct cggttttgcc ctcctggtta ggagagctcc
     5941 atttactcgg aatgtgggcg ggggccgcgg ctggctggtc cccctcctga agtatgtggg
     6001 tggtgtgtag gaatctagcc ccctcccacg ctcgtccact gcgggagtgg catgggcgga
     6061 tcgcaccggt agaggggccg cagtccgagg aaccgctggg gagatcagaa gaacaagcga
     6121 gaggccccgg gctctgggcc ctcccgaagc ccagcggaga cgcggaattg ggggtggggg
     6181 gtggggaaga agcgggcgcc caacggggcc agacctcggc cgtgaggagt gccggagcga
     6241 ccgtgggccc ccagccgctg ctgccgaact cctcccgaga ggcggccctg cttgccatca
     6301 cgcggctggg aggtacctgg gtagccgcag cgggtgggtc tctggcagcc ccctggggat
     6361 cggctcgggc gggcgtgcgt ggcctgggct tcagcctcgg cgaggggagt catgggcgac
     6421 ccggccctct ctccagagaa atccaggtac cgggagcagt gtttcctggg agctctgatg
     6481 tggtcgaccc aaaagcaaag cgatattttc gctgtctcga ctgaaggagg gaactcggcc
     6541 ctcaggagac tgaggggagg ggatcaggcg cctcttggag aaccaccctc atctgccagt
     6601 aagggtggca ccttcacgtt tttttttttg ttgttgttgt tttctcacac gtttgattat
     6661 taaacaacga ggagaagtcc gttttttgct gttctttttc gttttttccc ccctctcttt
     6721 tcttttggta ccatatgtag caaatagatt ttttaaaatc ataagaccac catcctcacc
     6781 atcttgtttt tcagtttcct cgtctccaga ttcttaacaa agcagtttca cttccctgat
     6841 gatggttatc ctcatctcat ggccaggtta ttttcttgta cttaagagca atcactgttt
     6901 attaagcagt ttcccgaatg ctgaaccttt gaagtgttac ctttccttgc aaaagattcc
     6961 gtatagaata ggattaaaaa ttttcacaag ttgtcagaga aaaataagaa cagaaaattg
     7021 aataaaatgt cagacctctg gaaaatgaac agctttctca aatttgaaaa ttaactataa
     7081 aaaggaacag ttttcctacg gagacactga ggcgctctca gtgaaaaaga acgatgaaaa
     7141 agaaccagaa aaggaaagaa aacggagtta tgtatatgat ttgtatctga tgcaaatttt
     7201 tcatacttgt gaaagaaaaa tatcaagatt ataaaaagat aaatggtgaa atgaagaatc
     7261 atttatggaa taaaatacaa atcaaagcaa gtctggatta tcgttttaca actactagta
     7321 aaaacagtaa cagcaaccac tcctggaagg ttacctagaa atttgcatat tcgtttatgt
     7381 gaggtggcaa ggctttggag ttagaaatat ggctctgcag ctaattttac aatttgggac
     7441 ctaatttcgt catcgtcctt ttgtccattt ataaaataga ggaaattata cctacttcag
     7501 gagtttgcca agattaactg tgtaaaactg acctttagca tgtatacatt tattctttcc
     7561 ctagtcacac tgcactgggg gacatttgtg aatctatgaa atttgtgaaa aatggatcct
     7621 ttaagccatg accctgaaac cccactcctg ggaacttacc tgcaatggaa gaaattcgga
     7681 aagaagaaaa gctgcattca cccacagggc tcagaatgat ctaaaattag atccagtcca
     7741 gagacaacct aaaggtatta agaaaatagc agggcagcag ctaagaaaat catagcactt
     7801 taactgaaag gaacattgtg taacccatca cgtggcataa ttttagagcc tctctgtgat
     7861 atataggaaa aaagtgacag gtcaaagtaa gattactcag acatggatgc atatgtggaa
     7921 aatctgaata aaaaatggac ccacagtttt ctgtgtatgg gaggagagtt cagtgtcatg
     7981 tttgctgctt ttttttagtc agcgtcatct cttttaaaaa tactatcata tttttttcct
     8041 tgagtagatt cattagtggt ttaataattt atatactgtt attctattaa ataatccgtt
     8101 cttagattta tcaattatag tttgtttttt tttttaag

>ra 300 bp above exon 1
     2281 tacatcagtg atgctgcctt tcaccactga aaggcattta cggtggttta tgtatgatat
     2341 caaataaaga gtatttaaca cttctttata gttgaaaaag aaaggaaaga agggaatcaa
     2401 ccgagaatga taaaccaaca ttcaatggcc aatatacttt ctaagcctct aattctttta
     2461 tagtttatgg ggaaatgtca aaaatcttcc tctttaccaa tttcttgtta ccaaagttcc
     2521 acgatggctt tttctttccg ttaggtaacc tttcattttc tcgactaccc attatgtaac
     2581 gggagcgctg ggttctggat cagtcttcca ttaaagatga cttttatagt ctgtgagcgt
     2641 cgtcacagag tgctgacact ggggtgggga ggggagtacg gggggagggg gttaaacaga
     2701 taacaagcat ttaagccagt acggagcggt gactcatccc accgcgagaa gccattggtg
     2761 agcatcacgc tccgcccctc gccccgccca gcccccggcc tgtcgggtcc ctcaccacgc
     2821 cccgctcccc c

>mo 300 bp above exon 1
     8041 tgagtttgag gtcagcttaa attacttagt aggaacacca ggccaaattg ggctatggga
     8101 ttgtctccaa agataaagaa aaaagggaag gagagaaaag aaaaagaaag gaaagaaggg
     8161 gaaaagaagg aatcagcaga gaataaataa gtcaacatgc aatggccaat atactttcta
     8221 ggcctctaat tcttttatag tttgtgggaa aatgtcgaaa atcttcgtta ccaatttctt
     8281 gttaccaaag ttcaacgatg gcttcctcgc tccgttaggt aacctttcat tttctcaact
     8341 acccattatg taacgggagc attgggtact ggatcagtct tccattaaag atgattttta
     8401 tagttgctga gcgtcgtcag ggagtgctga cactgggggc ggtttaaaca gatacaagca
     8461 tttaagccag tccggagcgg tgactcattc ccccaccccc cacccccccg cgagagacgc
     8521 ggcgcggcca ttggtgagca tcacgccccg cccctcgccc agcctagctc ccgcctgccc
     8581 cgcccctttc cactcccggc tcccccgcgt t

>ha 300+ above exon 1
        1 tcgaaaatct ccctctttag caatttcttg ctcctagagt ttcagcaatt gctttctcgc
       61 tccattaggc aacctttcat tttctcacct tccccattat gtaacgggag caatgggttc
      121 tggaccagtc ttccattaaa gatgattttt atagtcggtg agcgccgtca gggagtgatg
      181 acacctgggg gcggtttaaa ccgtacaatc ccttaaacca gtctggagcg gtgactcatt
      241 tccccaggga gaagtggcgc ggccattggt gagcacgacg caagccccgc cccacccagc
      301 ccggccccgc cctgctaccc ctcctgactc actgccccgc ccgctccccc gcg

>hu above exon 1
attcctg agcctttcat tttctcgatt
    12361 tctccattat gtaacgggga gctggagctt tgggccgaat ttccaattaa agatgatttt
    12421 tacagtcaat gagccacgtc agggagcgat ggcacccgca ggcggtatca actgatgcaa
    12481 gtgttcaagc gaatctcaac tcgttttttc cggtgactca ttcccggccc tgcttggcag
    12541 cgctgcaccc tttaacttaa acctcggccg gccgcccgcc gggggcacag agtgtgcgcc
    12601 gggccgcgcg gcaattggtc cccgcgccga cct

>co 300 above exon 1
attccct aatctttcat tttctccatt acgtaacgag
      541 aagctggggc tttggccgat tttcccttta aagatgattt ttatcgtcaa caagcaattt
      601 cagggagtga tgagccgggg aggcggtatt agctgatgct agcgtttaag ctagtctcaa
      661 ctcgtttttc ccagggactt agattcctgg gtctgccagt aaaccccggg cgccggcagc
      721 gggtgcgcct gagcgtcgcg cgcgccgtcg cctccccgcc cctgcccctc ctcctccgcc
      781 cggcgactta cccgccctag ttg

>sh 240 bp above exon 1
tttcc ctctaaagat gatttttatc gtcaacaagc
     5461 aatttcaggg agtgatgagc cagggaggcg gtgttagttg atgctagcgt ttatgctagt
     5521 ctcaactcgt ttttcccagg gacttagatt cctgggtctg ccggtaaacc ccgggcgccc
     5581 gcagcgggcg cgcctgagcg tgcgcgcgcc gtcgcctccc cccccccgca gctcctcctc
     5641 tgcacggcga ctcaccagcc ctagt




>ra bp above exon
ttctttccgttaggtaacctttcattttctcgactacccattatgtaacgggagcgctgggttctggatcagtcttccattaaagatgacttttatagtctgtgagcgtcgtcacagagtgctgacactggggtggggaggggagtacggggggagggggttaaacagataacaagcatttaagccagtacggagcggtgactcatcccaccgcgagaagccattggtgagcatcacgctccgcccctcgccccgcccagcccccggcctgtcgggtccctcaccacgccccgctccccc

>mo bp above exon
ccgttaggtaacctttcattttctcaactacccattatgtaacgggagcattgggtactggatcagtcttccattaaagatgatttttatagttgctgagcgtcgtcagggagtgctgacactgggggcggtttaaacagatacaagcatttaagccagtccggagcggtgactcattcccccaccccccacccccccgcgagagacgcggcgcggccattggtgagcatcacgccccgcccctcgcccagcctagctcccgcctgccccgcccctttccactcccggctcccccgcgtt

>ha above exon
tcgaaaatctccctctttagcaatttcttgctcctagagtttcagcaattgctttctcgctccattaggcaacctttcattttctcaccttccccattatgtaacgggagcaatgggttctggaccagtcttccattaaagatgatttttatagtcggtgagcgccgtcagggagtgatgacacctgggggcggtttaaaccgtacaatcccttaaaccagtctggagcggtgactcatttccccagggagaagtggcgcggccattggtgagcacgacgcaagccccgccccacccagcccggccccgccctgctacccctcctgactcactgccccgcccgctcccccgcg

>hu above exon
attcctgagcctttcattttctcgatttctccattatgtaacggggagctggagctttgggccgaatttccaattaaagatgatttttacagtcaatgagccacgtcagggagcgatggcacccgcaggcggtatcaactgatgcaagtgttcaagcgaatctcaactcgttttttccggtgactcattcccggccctgcttggcagcgctgcaccctttaacttaaacctcggccggccgcccgccgggggcacagagtgtgcgccgggccgcgcggcaattggtccccgcgccgacct

>co above exon
attccctaatctttcattttctccattacgtaacgagaagctggggctttggccgattttccctttaaagatgatttttatcgtcaacaagcaatttcagggagtgatgagccggggaggcggtattagctgatgctagcgtttaagctagtctcaactcgtttttcccagggacttagattcctgggtctgccagtaaaccccgggcgccggcagcgggtgcgcctgagcgtcgcgcgcgccgtcgcctccccgcccctgcccctcctcctccgcccggcgacttacccgccctagttg

>sh bp above exon
tttccctctaaagatgatttttatcgtcaacaagcaatttcagggagtgatgagccagggaggcggtgttagttgatgctagcgtttatgctagtctcaactcgtttttcccagggacttagattcctgggtctgccggtaaaccccgggcgcccgcagcgggcgcgcctgagcgtgcgcgcgccgtcgcctccccccccccgcagctcctcctctgcacggcgactcaccagccctagt

cow and sheep intron 1 are fully alignable w/o intervening repeats, 91% identical


cow             GTAAATAGCCGCGTAGTCCTTTAAACTCCCAGCGGAGGACGCCAACCCTGGGTCTTGCGG 60
sheep           GTAAATAGCCACGTAGTCCTTTAAACCCCCAGCGGAGGCCGCC---CCCGG--CTTGCGG 55
                ********** *************** *********** ****   ** **  *******

cow             CCGAGGCCC-AGGG-ACCCAGCCGAATCGGATTGG-TGGGAGGCAGACCTTGACCGTGAG 117
sheep           CCGAGGCCCTAGGGCACTCAGCCGGATCGGACTGGCTGGGAGGCAGACCTTGACCGTGAG 115
                ********* **** ** ****** ****** *** ************************

cow             TAGGGCTGGGGGCTTGCGGCGGGCGCGGGGAACGTCGGGCCTGTTGAGCGTGCTCGTTGG 177
sheep           GAGGACTGGGGGCTTCCGGCGGGCGCGGGGAACGTCGGGCCTGTTTAGCGTGCTCGTTGG 175
                 *** ********** ***************************** **************

cow             TTTTTGCCAGCCGCCGCTCGGTTTTACCCTCCTGGTTAGGAGAGCTCCATTTACTCGGAA 237
sheep           TTTTTGCCAGCCACCGCTCGGTTTTGCCCTCCTGGTTAGGAGAGCTCCATTTACTCGGAA 235
                ************ ************ **********************************

cow             TGTGGGCGGGGGCCGCGGCTGGCTGGTCCCCCTCCCGAGGTATGTGGGTGGTGTGTAGGA 297
sheep           TGTGGGCGGGGGCCGCGGCTGGCTGGTCCCCCTCCTGAAGTATGTGGGTGGTGTGTAGGA 295
                *********************************** ** *********************

cow             ATCTAGCCCCCTCCCACGCTCGTCCACTGCGGGAGTGGGATGGGCGAATCGCACCGGTAG 357
sheep           ATCTAGCCCCCTCCCACGCTCGTCCACTGCGGGAGTGGCATGGGCGGATCGCACCGGTAG 355
                ************************************** ******* *************

cow             AGGGGCCGCAGTC-GAGGAACCGCTGGGGACCTCAGAAGAACAAGGGCGAG--CCCGGGA 414
sheep           AGGGGCCGCAGTCCGAGGAACCGCTGGGGAGATCAGAAGAACAAGCGAGAGGCCCCGGGC 415
                ************* ****************  ************* * ***  ****** 

cow             TTTGGGCCCTCCCGAAGCCCAGAGGAGTCGCGGAATTGGGGGTGGGGGTGGTGGGGAAGA 474
sheep           TCTGGGCCCTCCCGAAGCCCAGCGGAGACGCGGAATTGGGGGTGGGG--GGTGGGGAAGA 473
                * ******************** **** *******************  ***********

cow             AACGGGCGCC-AACGGGGCCCGACCTCGGCGGTGAGGAGTGCCGGAGCATCCGTGGGCCC 533
sheep           AGCGGGCGCCCAACGGGGCCAGACCTCGGCCGTGAGGAGTGCCGGAGCGACCGTGGGCCC 533
                * ******** ********* ********* *****************  **********

cow             CCAGCCGCTGCTGCCGAACTCCTCCCGAGAGGCGGCCCTGCCTGCCATCACGCGGCTGGG 593
sheep           CCAGCCGCTGCTGCCGAACTCCTCCCGAGAGGCGGCCCTGCTTGCCATCACGCGGCTGGG 593
                ***************************************** ******************

cow             AGGTACCTGGGTAGCCGCAGCGGGTGGGTCTCTGGCAACCCCCCGGGGATCGGCTCTGGC 653
sheep           AGGTACCTGGGTAGCCGCAGCGGGTGGGTCTCTGGCAGCCCCCTGGGGATCGGCTCGGGC 653
                ************************************* ***** ************ ***

cow             GGGCGTACGTGGCCTGGGCTTCAGCCTCGGCGCGGGGAATCATGGGCCACCTGGCGCTCT 713
sheep           GGGCGTGCGTGGCCTGGGCTTCAGCCTCGGCGAGGGGAGTCATGGGCGACCCGGCCCTCT 713
                ****** ************************* ***** ******** *** *** ****

cow             CTCCGGGCCAGAGAAATCCAGGTACCGGGAACAGTGTTTCCTGGGAGCTCTGATGTGGTG 773
sheep           CTCC-----AGAGAAATCCAGGTACCGGGAGCAGTGTTTCCTGGGAGCTCTGATGTGGTC 768
                ****     ********************* **************************** 

cow             GACCCAAAAGCAAAGCGAAATTTTCCCTGTCTCGACTGATCCTCCAGAAGGAGGGAACTC 833
sheep           GACCCAAAAGCAAAGCGATATTTTCGCTGTCTCGACT---------GAAGGAGGGAACTC 819
                ****************** ****** ***********         **************

cow             GGCCGTCAGGAGACTGAGGGGAGGGGATTCAGGCGCCTCTCAGAGAACCACCCTCATCTG 893
sheep           GGCCCTCAGGAGACTGAGGGGAGGGGAT-CAGGCGCCTCTTGGAGAACCACCCTCATCTG 878
                **** *********************** ***********  ******************

cow             CCAGTAAGGGTGGCACCTTCACGCTTGATTTTTTTTTTTTTTTCCC--CTCACACGTTTG 951
sheep           CCAGTAAGGGTGGCACCTTCACGTTTTTTTTTTTGTTGTTGTTGTTTTCTCACACGTTTG 938
                *********************** **  ****** ** ** **     ************

cow             ATTATTAAACAACGAG---AAGTCCGTTTTTTGCTGTCCTTTTTCGTTTTTGTTTTTTTT 1008
sheep           ATTATTAAACAACGAGGAGAAGTCCGTTTTTTGCTGTTCTTTTTCGTT----TTTTCCCC 994
                ****************   ****************** **********    ****    

cow             TTTTCCTTTTCTTTTGGTACCATATGTAGCAAATAGATTTTTTAAAATCATAAGCCCACC 1068
sheep           CCTCTCTTTTCTTTTGGTACCATATGTAGCAAATAGATTTTTTAAAATCATAAGACCACC 1054
                  *  ************************************************* *****

cow             ACCCTCACCATCTT-TTTTTCAGTTTCCTCGTCTCCAGATTCTTAACAACAAAGCAGTTT 1127
sheep           ATCCTCACCATCTTGTTTTTCAGTTTCCTCGTCTCCAGATTCTTAACAA---AGCAGTTT 1111
                * ************ **********************************   ********

cow             CACCTCCCTGATCATGGTTATCCTTATCTCATGGCCGGGTTATTTTCTTGTACTTAAGAG 1187
sheep           CACTTCCCTGATGATGGTTATCCTCATCTCATGGCCAGGTTATTTTCTTGTACTTAAGAG 1171
                *** ******** *********** *********** ***********************

cow             CAATCACGTTTTATTAAGCAGTTCCCCGAATGCTGAACCTTTGAAGTGTTACCTTTCCTT 1247
sheep           CAATCACTGTTTATTAAGCAGTTTCCCGAATGCTGAACCTTTGAAGTGTTACCTTTCCTT 1231
                *******  ************** ************************************

cow             ACAAAAGATACCACATAGAATAGGATTAAAAATTTTCACAAGTTGTCAGAGAAAAATAGG 1307
sheep           GCAAAAGATTCCGTATAGAATAGGATTAAAAATTTTCACAAGTTGTCAGAGAAAAATAAG 1291
                 ******** **  ******************************************** *

cow             AACAGAAAATTGTATAAAAATGTCAGACCTCTGGAAAATGAACAGCTCTCTCAGATTTGA 1367
sheep           AACAGAAAATTGAATAAAA-TGTCAGACCTCTGGAAAATGAACAGCTTTCTCAAATTTGA 1350
                ************ ****** *************************** ***** ******

cow             AAATTAACCTATGAAAAGGAACAGTTTTCCTACGGAAACATTGAGGTGCTCT-------- 1419
sheep           AAATTAAC-TATAAAAAGGAACAGTTTTCCTACGGAGACACTGAGGCGCTCTCAGTGAAA 1409
                ******** *** *********************** *** ***** *****        

cow             ---AACAATGAAAAAGAATCAGAAAAGGAAA-AAAACAGAGTTAGGATGTGATTTGTATA 1475
sheep           AAGAACGATGAAAAAGAACCAGAAAAGGAAAGAAAACGGAGTTA----------TGTATA 1459
                   *** *********** ************ ***** ******          ******

cow             TGATTTGTATCTGATGCAAATTTTTCATACTTGTGAAAGAAAAATATCAAGATTATAAAA 1535
sheep           TGATTTGTATCTGATGCAAATTTTTCATACTTGTGAAAGAAAAATATCAAGATTATAAAA 1519
                ************************************************************

cow             AGATAAATGGTGAAATGAACAATCATTTATGAAATAAAATACAAATCAAAGCAAGTCTGG 1595
sheep           AGATAAATGGTGAAATGAAGAATCATTTATGGAATAAAATACAAATCAAAGCAAGTCTGG 1579
                ******************* *********** ****************************

cow             ATT-------TACAACTACTAGTAAAAACAACAGTAACAGCAACCACTTCTGGAAAGTTA 1648
sheep           ATTATCGTTTTACAACTACTAGTAAAAACA---GTAACAGCAACCACTCCTGGAAGGTTA 1636
                ***       ********************   *************** ****** ****

cow             CCTAGAAATTTGCATATTCAGT-ATGTGAGGTGGCAAGGCTTTGGAGTTAGAAATATGG- 1706
sheep           CCTAGAAATTTGCATATTCGTTTATGTGAGGTGGCAAGGCTTTGGAGTTAGAAATATGGC 1696
                *******************  * ************************************ 

cow             TCTGCAACTAATTTTACAATTTGGGACCTAATTTCCTCATCCCCCTTTTGGACATTCATA 1766
sheep           TCTGCAGCTAATTTTACAATTTGGGACCTAATTTCGTCATCGTCCTTTTGTCCATTTATA 1756
                ****** **************************** *****  *******  **** ***

cow             AAATAGAGGAAATTATACCTACTTCAG-AGTTTGCCAAGATTAACTGTGTAAAACTGACC 1825
sheep           AAATAGAGGAAATTATACCTACTTCAGGAGTTTGCCAAGATTAACTGTGTAAAACTGACC 1816
                *************************** ********************************

cow             TTTAGTGTGTATACTTTTATTCTTTTCCTAGTCACACTGCACTGGGGGACGTT-GTGAAT 1884
sheep           TTTAGCATGTATACATTTATTCTTTCCCTAGTCACACTGCACTGGGGGACATTTGTGAAT 1876
                *****  ******* ********** ************************ ** ******

cow             CTGTATGAAATTTGTGAAAAACAGTCAGGTGATCCTTTAAGCCATGACCCTAAAACCC-A 1943
sheep           CT--ATGAAATTTGTGAAAAATGG-------ATCCTTTAAGCCATGACCCTGAAACCCCA 1927
                **  *****************  *       ******************** ****** *

cow             CTCCTGGGAACTTACCTGTAATGGAGGAAACCAGGAAAGAAGAAGAAAAGCTGCATTCAC 2003
sheep           CTCCTGGGAACTTACCTGCAATGGAAGAAATTCGGAAAGAAGAA---AAGCTGCATTCAC 1984
                ****************** ****** ****   ***********   *************

cow             CCACAGAACTCAGAATGATCTAAAATTAGATCCAGTCCGGAGTCAACCTAAATGTATTAA 2063
sheep           CCACAGGGCTCAGAATGATCTAAAATTAGATCCAGTCCAGAGACAACCTAAAGGTATTAA 2044
                ******  ****************************** *** ********* *******

cow             TAAAATAGCAGGGCAGCAGCTAAGAAAATCATAGCACTTTAACTGAAAGGAACATTGTGT 2123
sheep           GAAAATAGCAGGGCAGCAGCTAAGAAAATCATAGCACTTTAACTGAAAGGAACATTGTGT 2104
                 ***********************************************************

cow             AACC-ATCACGAGTCATAATTTTAGAGCCTCTCTGTGATATACAGGAAAAAACTGACAGG 2182
sheep           AACCCATCACGTGGCATAATTTTAGAGCCTCTCTGTGATATATAGGAAAAAAGTGACAGG 2164
                **** ****** * **************************** ********* *******

cow             TCAAAGTAAGATTACTCAGACATGGATGCGTTTGTGGAAAATCTGAATGAAAAATGAATC 2242
sheep           TCAAAGTAAGATTACTCAGACATGGATGCATATGTGGAAAATCTGAATAAAAAATGGACC 2224
                ***************************** * **************** ******* * *

cow             CACAGTTTGCTGTGTATGGGAGGAGAGTTCAGTGTCACGTTTGCTGCTTTTTTTAAGTTA 2302
sheep           CACAGTTTTCTGTGTATGGGAGGAGAGTTCAGTGTCATGTTTGCTGCTTTTTTTTAGTCA 2284
                ******** **************************** **************** *** *

cow             GCATCATCTCTTTTTTAAAAATACTATCATATTTTTTCCCT-GAGTAGATTCATTAGTGG 2361
sheep           GCGTCATCTCTTT--TAAAAATACTATCATATTTTTTTCCTTGAGTAGATTCATTAGTGG 2342
                ** **********  ********************** *** ******************

cow             TTTAATAATTTATATACTGTTATTCTGTTAAATAATCCGTTCTTAGATTTATCAATTATA 2421
sheep           TTTAATAATTTATATACTGTTATTCTATTAAATAATCCGTTCTTAGATTTATCAATTATA 2402
                ************************** *********************************

cow             GTTTTTTCTTTTTTTTTTAAG 2442
sheep           GTTTGT--TTTTTTTTTTAAG 2421
                **** *  *************

rat and mouse are 81% identical over intron 1

ra              GTAAGCGGGCTGCTGAAGCCAGGCGTCAGCGAGCATTCAGCCTTCCTCCCGTCGACAAGC 60
mou             GTAAGCGGGCTGCTGAAGCCAGGCCTTGGCGAGCACTCAGCCTTCC----GTCGTCAAGC 56
                ************************ *  ******* **********    **** *****

ra              TCGGCTTACTGTGCCTCTCCGGGACTTGAGGCCGCGGGG-------------CTGGGACT 107
mou             TCGGCTCACTGCGCCTCTCGGGGCCTTGAGGCCACGGGGACTAGGACTGGGACTGGGACT 116
                ****** **** ******* *** ********* *****             ********

ra              GGGGTTGAGCTTGGCTAGGAGGTGGCTGTGCACCCGCTGTGCGCGACTCCTGGAGGGACC 167
mou             GGGGCTGAGTCTGGCTGGGAGGTGACTGTACACCCCCTGTGCGCGACTCCTGGAGGAACC 176
                **** ****  ***** ******* **** ***** ******************** ***

ra              GAATCCCAGGGCAGCGAGGCCGGGAGCC--------------GAGCCTGATTCACAGCTC 213
mou             GAATCCCAGGGCAGCCAGGCCGGGAGCCAGCCTTTCCTTCCCGAGCCAGATTCACAGCTC 236
                *************** ************              ***** ************

ra              AACATCGCTGTGGGGGATGGGGGGTTGGGGGGGTGGCATCTTTTAACTGCCCTGTGCTGT 273
mou             AGCATCGCT---GGGGATGG----------GGGTGGCATCTTTTGACTGTCCTTGGCTGT 283
                * *******   ********          ************** **** ***  *****

ra              TTTCTTCTCTCGTTGTAATAGCTACAGCGAACATAATTTCACCCCGTGATTCCACCACGG 333
mou             TTTCTTCTCTCTTTGTAGTAGCTACAGCGAACATAATTTTACCTCGTTATTCCACCACAG 343
                *********** ***** ********************* *** *** ********** *

ra              TCTCATCCGTCCTCAGCACCACACTCATTGCTCCCCTTGCTCAGTTTCATACTCAGCGCA 393
mou             TC------------------------ATTACTCCC-TTGCACAGTTTCATTCTCAACGTC 378
                **                        *** ***** **** ********* **** **  

ra              GCCGTTCGCCTTCACTGCCCTGCCTAGGCGTTTTCATGGTTGTCTTATATTCTTTTACTT 453
mou             GCCGTGCGCCTTCACTGCCCTGTCTAGGCGTTTTCATGATTGTCT-ATTTTCTTGTACTT 437
                ***** **************** *************** ****** ** ***** *****

ra              TGAATATCGTGGTTTAATAGCAGTTGCCGGTGTGCTAAATTCCTCATTTCCTTAAGAGAA 513
mou             TGAATACCGTGGTTTAATAGCAGTTGCGGGTGCGCAGAATTCTCCATTTCCTTAAGAGAA 497
                ****** ******************** **** **  *****  ****************

ra              ACTCCTGGGAGGATGGAATTAAAGACGTTGCAAATTTAATTATACCACAAACAGGAATCA 573
mou             ACTCCTGGGAGAATGGGACTAAAGACGT-GCAAATTTAATTATATCGCAAACAGGAATCA 556
                *********** **** * ********* *************** * *************

ra              AAATTTTGCATTAAAATGCCAGACATCTTGAAAAATTTAACTATTCAATAAAAAAAAAAA 633
mou             AAATTTTGCATTAAAATGCCAAACATCTTGAAAAATT-AACTATTCAATGAAGAAAA--- 612
                ********************* *************** *********** ** ****   

ra              AGGAACTACTTTACCTACACACACATCCGAGTGCTTCAAAGAGTCCAAGGAAATAGAAAG 693
mou             -GGAACTACTTTACCTACACACACATCCGAGAGCTTCGAGGAGGCGAAGGAAATAGAAAG 671
                 ****************************** ***** * *** * **************

ra              CTAAGGGATGATTTGGGTTGTATTTGAATCTGACACGAGCTTTCCATATTATTTATAGCA 753
mou             CTAAGGGATGATTTGGGTTGTATTTGAATCTGACACAAGCTTTCCATATTATTTATAGCA 731
                ************************************ ***********************

ra              GGGACTGAAGGATGAGTCATTTTCTGAATAAGATGCAAATTAAAGCAAGTTTGTT----G 809
mou             GGGACTAAACGATGAGTCATTTTCTGAATAAGATGCAAATTAAAGCAAGTTTGTTTGTTG 791
                ****** ** *********************************************    *

ra              TCTTTACATCGATTAAACAGACAGAGATGATGACAGCAGCAACCCTAACCTAGAGGTTGT 869
mou             TCTTTACATCTATTAAATAGACAGAGACAATGGCAACAGCAACCCTAACCTAGAGGTTGC 851
                ********** ****** *********  *** ** *********************** 

ra              CTGAAACCACCGTGTTCAAGTTTGGGGAGCAGGTGGCCCTCCTTAAGAGCTCGATTGATT 929
mou             CTGAAA-----GTGT-CAGGTTTGGG-AACAAGTGGCCCTGCTTAAGGGCTAGAAAGATT 904
                ******     **** ** ******* * ** ******** ****** *** **  ****

ra              GCTTTACAACCAACGTT-ATGACTTGGCATTGCCTGGGGTTCCTTTTATTTATTCCTTTC 988
mou             GCTTTACAACCAACAATCATGACTTGACATTGCCTGGGGTTCCTTTTGTCTATTCCTTT- 963
                **************  * ******** ******************** * ********* 

ra              TTTAAAAGACTACTATCTATTTTATGAGCATGAGTGTTTCGC-TCCACAGAAGCATGTAT 1047
mou             TTTAAAAGACTAGTGTTTATTTTATGTGCATGAGTGTTTTGCATCCACATTCGCCTGTAT 1023
                ************ * * ********* ************ ** ******   ** *****

ra              ACAAGCCTGGTTCTGCGGAGGTCAGAAGAGACAGGGTGTTGGAAGCCCTGGAACTAGAGC 1107
mou             ACACACCTGGTTCTGTGGAGGTCAGGAGA----GGGTGCTGGATGCCCTGGCACTAGAGC 1079
                ***  ********** ********* ***    ***** **** ******* ********

ra              TAGGGATGATTCTGTGAGCCCCTGCCACAGGGGAGCTCAGATCCCCAATCCAGGCTGTCT 1167
mou             CGTGAATGGTTATGTGAGCCCCTGCCACAGGGGAGCTCAGAACCA-AATCCAGGTCCTCT 1138
                   * *** ** ***************************** **  ********   ***

ra              GGAAGAGCAGCCAGAGCTCTTAA--CTACCGAACACCCCCCCCCCCATCCCCTCTCATTC 1225
mou             GGAAGAGCAACCAGAGCTCTTAAAACTTCTAAGTATCCCTC----CATCCCCTTTCCATC 1194
                ********* *************  ** *  *  * *** *    ******** **  **

ra              ACATTTAGAAAGGAGAAAACTGCTACCCATGTCTGGCATTTATTTCAGAGATTAACTGT- 1284
mou             ATATTTGGAAAGGAGAAAACTGCTACCCATGCCTGGCATTTATTTCAGAGATTAACTGTC 1254
                * **** ************************ *************************** 

ra              ---GCAAAACTCGATGT-GAAAGTATACTATTCTGTTTCCCAGTCACACTTAGTTGACAG 1340
mou             TGTGTAAAACTTGACATTGAAAGTGCACTATTCTGTTTCCCATTCATACTTAGTTGAGAC 1314
                   * ****** **  * ******  **************** *** ********** * 

ra              T---GTAAGTCAGTAAGGGCTTTGGTTGGTTGGTTTGGTTGGTTGGTTCCTGGGTTAGTC 1397
mou             TACTGTAAGTCAGTTAGGGCTTT------TT-------TTGTTTGGTTCCTTGGTTAGTT 1361
                *   ********** ********      **       *** ********* ******* 

ra              TGGA-TGTGCTTGTTGAGAGCTCAATAACAGGCTTTCAATATGGATATGTAGCTGGGAAT 1456
mou             TGGAGTGTGTTTGT---GAGCTCATTAACAGGCTTTCAGTAT------GTAGCTGA-AAT 1411
                **** **** ****   ******* ************* ***      *******  ***

ra              TCGCTATGTAGACCAGGCAGGCCTCAAATTTGTGGCAATCCTCCCTGTGATTCCCCAGAA 1516
mou             TTGCTGTGTAGACCAGACAGGCCTCAAATTTGTGGCAATCCTCCCTGCATCTTCCCAGAA 1471
                * *** ********** ******************************    * *******

ra              TGCCCTGGTACAGGCATAAGCCACTGTGCCCAGCCGTAAAACAATCTGGTGAGGTATTAT 1576
mou             TGCCCTGGTACAGGCATAAACCACCGTGCCCAGCAGTAAAACAATCTGGTGAGGTATTAT 1531
                ******************* **** ********* *************************

ra              TAGTTGCATGCTGTGACCCAGAAACCCCACTTCTGGCAATTCACCTGCCGTGGTGGAACC 1636
mou             TAGTCGTGTGCTGTGACCCAGAAACCCCACTCCTGGCAATTTACTGG----GAAGGAACA 1587
                **** *  *********************** ********* **  *    *  ***** 

ra              AACAAAGGGCTAGGGGAGCCATATGGCCAACAGTTACAGAAAATTAGATCCAAGGGAAAA 1696
mou             AACAAAGGGCTAGGGGAGCCATATGGCCTGCAGTTAGAGAAAATTAGATCCAACTGAAAA 1647
                ****************************  ****** ****************  *****

ra              G-CAACCTAAATGTTTAACAGGCGAGCAGCTAAGAAACTGACAGGCTCGTGAGGGA-GCT 1754
mou             ATCAACCTAAAGGTGTAAAAGCCAAGCAGTTAAGAAACTGACAGGCTCATGATGGAAGCC 1707
                  ********* ** *** ** * ***** ****************** *** *** ** 

ra              GTAGCAATCCCGAAGAACACTCTTCATTTTAGACTCCATGTATCCCTGGGAAAAAC--AG 1812
mou             GAGGCCATCGTGAA---CACTCTTCATTTTAGGCCCCACGTATCACTGGGGACAACTGAG 1764
                *  ** ***  ***   *************** * *** ***** ***** * ***  **

ra              AGTCAAAGTACAGGTTAGGAGACCGGGACTCCTCTGGACCCATGCTGTC-CTCTGAAAAG 1871
mou             AGTCAAAGTACAGGTAAGGAGACCAAGGCTTTTCAGGACTCAGGCTGTCTCAGTGAAAAG 1824
                *************** ********  * **  ** **** ** ****** *  *******

ra              CCCAGAAGAGCTATAAT-GAAAGAGCTCAGAAGATGT--CTGATCTTGGCTTTCTTTATG 1928
mou             CCCAGAAGAGCAGTAATTGAAAGAGCTCAGACGATGTGTCTGATCTCC----TCTGTTTG 1880
                ***********  **** ************* *****  *******      *** * **

ra              TTTGTTGCTGTATTGTTTCCACTAACAAACAACTAAAAAAAAAAAAAAAGTTCACAGGCT 1988
mou             TTTGTTGCTGTATTATTTCCACTAACTTATTTGGGAGGAAAAAAAACA-GTTCACAGGCT 1939
                ************** ***********  *      *  ******** * ***********

ra              TCTTTCCTTAAAATACTGGGGATTG---------AACCCAGGGATAGTTTTTTAGTGTCT 2039
mou             TCTTTTCTTGAAATACTGGGGATTGCTGGGATCGAACCCAGGGATAGGTTTTTAGTTTCT 1999
                ***** *** ***************         ************* ******** ***

ra              AAATTAACAT-GACCATGCCCTGTTTGCCTTTTTGGAGTATGTTTGAATCTGCCCTTATT 2098
mou             AAAATAACATAGATCATGCCCTGTTTGC-TTTTTGGAATATGTTTGCG-CTGCCCTTATT 2057
                *** ****** ** ************** ******** ********   ***********

ra              TCCATTCTCAAATACTGCTCCATTTTATATGACTATTTAGTTTTGGCTTGATAATTTGCA 2158
mou             TTCATGTTCAAATACTGCTCCATTTTGCGTGACTCTTTAGTATTGGTTTGATGATTTGCA 2117
                * ***  *******************   ***** ****** **** ***** *******

ra              TATGAGATTAGATCATCTTTCAGTTCTCAGACTTATTTATCAATTCTAGTTTT-TCTTTT 2217
mou             TATTAGATTAGATTGTATTTCAGTTCTCAGACTTATTTATCAATTCTAGTTTTCTCTTTT 2177
                *** *********  * ************************************ ******

ra              TGTTGTTTTAAAG 2230
mou             TGTTGTTTTAAAG 2190
                *************

mouse and rat align fairly well upstream of motif 1 but not forever

ra              TACATCAGT--GATGCTGCCTTTCACCACT------GAA----AGGC--ATTTACGGT-- 44
mo              ----TGAGTTTGAGGTCAGCTTAAATTACTTAGTAGGAACACCAGGCCAAATTGGGCTAT 56
                    * ***  ** *    ***  *  ***      ***    ****  * **  * *  

ra              -GGTTTATGT---ATGATATCAAATAAAGAGTATTTAACACTTCTTTATAGTTGAAAAAG 100
mo              GGGATTGTCTCCAAAGATAAAGAAAAAAGGGAAGGAGAGA------AAA----GAAAAAG 106
                 ** ** * *   * ****   ** **** * *    * *       *     *******

ra              AAAGGAAAGAAGGG----------AATCAACCGAGAATGA-TAAACCAACATTCAATGGC 149
mo              AAAGGAAAGAAGGGGAAAAGAAGGAATCAGCAGAGAATAAATAAGTCAACATGCAATGGC 166
                **************          ***** * ****** * ***  ****** *******

ra              CAATATACTTTCTAAGCCTCTAATTCTTTTATAGTTTATGGGGAAATGTCAAAAATCTTC 209
mo              CAATATACTTTCTAGGCCTCTAATTCTTTTATAGTTTGTGGGAAAATGTCGAAAATCTTC 226
                ************** ********************** **** ******* *********

ra              CTCTTTACCAATTTCTTGTTACCAAAGTTCCACGATGGCTTTTTCTTTCCGTTAGGTAAC 269
mo              GT---TACCAATTTCTTGTTACCAAAGTTCAACGATGGCTTCCTCGCTCCGTTAGGTAAC 283
                 *   ************************* **********  **  *************

ra              CTTTCATTTTCTCGACTACCCATTATGTAACGGGAGCGCTGGGTTCTGGATCAGTCTTCC 329
mo              CTTTCATTTTCTCAACTACCCATTATGTAACGGGAGCATTGGGTACTGGATCAGTCTTCC 343
                ************* ***********************  ***** ***************

ra              ATTAAAGATGACTTTTATAGTCTGTGAGCGTCGTCACAGAGTGCTGACACTGGGGTGGGG 389
mo              ATTAAAGATGATTTTTATAGTTGCTGAGCGTCGTCAGGGAGTGCTGACACTG-----GGG 398
                *********** *********   ************  **************     ***

ra              AGGGGAGTACGGGGGGAGGGGGTTAAACAGATAACAAGCATTTAAGCCAGTACGGAGCGG 449
mo              -----------------GCGGTTTAAACAGATA-CAAGCATTTAAGCCAGTCCGGAGCGG 440
                                 * ** *********** ***************** ********

ra              TGACTCAT---------------CCCACCGCGAGAA----------GCCATTGGTGAGCA 484
mo              TGACTCATTCCCCCACCCCCCACCCCCCCGCGAGAGACGCGGCGCGGCCATTGGTGAGCA 500
                ********               *** ********           **************

ra              TCACGCTCCGCCCCTCGCCCCGCCCAGCCCCCGGCCTGTCGGGTCCCTCACCACGCCCCG 544
mo              TCACGCCCCGCCCCTCGCCCAGCCTAGCTCCCG-CCTGCCCCGCCCCTTTCCACTCCCGG 559
                ****** ************* *** *** **** **** *  * ****  **** *** *

ra              CTCCCCC----- 551
mo              CTCCCCCGCGTT 571
                *******  




14408-14504 human unrelated
7607-7703 sheep same as book
7773-7865 mouse


D26150 Bovine 803-855 3298-3395
Query: 9    gatcctttaagccatgaccctgaaaccccactcctgggaacttacctgcaatggaagaaa 68
            ||||||||||||||||||||| |||||| ||||||||||||||||||| |||||| ||||
Sbjct: 2770 gatcctttaagccatgaccctaaaaccc-actcctgggaacttacctgtaatggaggaaa 2828
Query: 69   ttcgga---aagaagaaaagctgcattcaccc 97
               |||   |||||||||||||||||||||||
Sbjct: 2829 ccaggaaagaagaagaaaagctgcattcaccc 2860

2461 actagtaaaa acaacagtaa cagcaaccac ttctggaaag ttacctagaa atttgcatat
     2521 tcagtatgtg aggtggcaag gctttggagt tagaaatatg gtctgcaact aattttacaa
     2581 tttgggacct aatttcctca tccccctttt ggacattcat aaaatagagg aaattatacc
     2641 tacttcagag tttgccaaga ttaactgtgt aaaactgacc tttagtgtgt atacttttat
     2701 tcttttccta gtcacactgc actgggggac gttgtgaatc tgtatgaaat ttgtgaaaaa
     2761 cagtcaggtg atcctttaag ccatgaccct aaaacccact cctgggaact tacctgtaat
     2821 ggaggaaacc aggaaagaag aagaaaagct gcattcaccc acagaactca gaatgatcta
     2881 aaattagatc cagtccggag tcaacctaaa tgtattaata aaatagcagg gcagcagcta
     2941 agaaaatcat agcactttaa ctgaaaggaa cattgtgtaa ccatcacgag tcataatttt
     3001 agagcctctc tgtgatatac aggaaaaaac tgacaggtca aagtaagatt actcagacat
     3061 ggatgcgttt gtggaaaatc tgaatgaaaa atgaatccac agtttgctgt gtatgggagg
     3121 agagttcagt gtcacgtttg ctgctttttt taagttagca tcatctcttt tttaaaaata
     3181 ctatcatatt ttttccctga gtagattcat tagtggttta ataatttata tactgttatt
     3241 ctgttaaata atccgttctt agatttatca attatagttt tttctttttt ttttaaggac
     3301 ttctgaatat atttgaaaac tgaacagttt caaccaagcc gaagcatctg tcttcccaga
     3361 gacacaaatc caacttgagc tgaatcacag cagatgtagg tacc

U29185 Homo sapiens 12634-12767 15390-15488 14413..14498 L1MC1 14583..14653 MIR 14752..14947 L1ME3
        
Query: 23    tgaccctgaaaccccactcctgggaacttacctgcaatggaagaaa 68
             |||||| ||||||||||||||| |||||||||||||||||||||||
Sbjct: 14755 tgacccagaaaccccactcctgagaacttacctgcaatggaagaaa 14800

     repeat_region   14413..14498 L1MC1  = 86 bp
     repeat_region   14583..14653 MIR    = 71 bp
     repeat_region   14752..14947 L1ME3 = 196 bp

    14401 atttacacaa taaaatgcaa attagagcat gtttgggtta tcattttaca tctattaaaa
    14461 taaccaaaat aattaatagt aacagcaacc cttgctggaa ggttgcccaa aacttggcat
    14521 tttcaagtgt ctggggaggt ggcagggctt tggggtcaca aagatggttc tgcagtcaat
    14581 tttgtgacct tggacaggct acctaatttc ctgatcctcc ttttgtccat tcatagaatg
    14641 gaggaaatga tagctacttt ctgcgtctgt atgtatgagt tattgggggc atttcgaacc
    14701 agtgacaaac attttgttaa gcaatctggt gatgcattaa gaagctggaa gctgtgaccc
    14761 agaaacccca ctcctgagaa cttacctgca atggaagaaa caaacaaaca aaaacaggca
    14821 tgtattccta gcagaatgat ctaaaattag aacacctgga aaagagccta aatgtataac
    14881 accagggcag tagctaagaa aattatgaca cattaactga aatgaacatt atgtaaccac
    14941 taaaaatcat gattttggag cctgtgatat gtggggaaaa actgacaagt aaaaaagtgg
    15001 gttattaact gcacctgctt actctaacgt gaacgcatat gtgaaaaatc tgaaaggaaa
    15061 agcacagaaa atggacgttt tcattgaaat tgtcggtgat cttaattttc ctttggtgaa
    15121 tatattgctc tcactaaggg cgtttaaaaa atagttcaca ggttttaatt ttttagatga
    15181 aatggaccca cagttttctg taagagaaag gagagattgt tatatttgct acttagaata
    15241 aaagattttt agccaacgtt gtttcctttt tcaaatattt ttccattttt ttagttgatt
    15301 aatgatttag taatttgtgt attgggtttt tttaagaatc agttcttaga ttcatttatc
    15361 aattctagtt ttttgttgtt gtttttaagg actcctgaat atttttcaaa actgaacaat
    15421 ttcagccatg tctgagcttt ccgtcttcct ggaggcacaa atctagttta gctgaaccac
    15481 aacagattgt acatatcctg cagaacctct gtggtcttag gaaggttgaa agtcaccaaa


U29186 Mus musculus short inc U52821 8612-8658 10849-10946 10044..10163 B1-F PB1D7
  
Query: 23    tgaccctgaaaccccactcctgg 45
             |||||| ||||||||||||||||
Sbjct: 10203 tgacccagaaaccccactcctgg 10225

 9841 cccctttcca tcatatttgg aaaggagaaa actgctaccc atgcctggca tttatttcag
     9901 agattaactg tctgtgtaaa acttgacatt gaaagtgcac tattctgttt cccattcata
     9961 cttagttgag actactgtaa gtcagttagg gctttttttg tttggttcct tggttagttt
    10021 ggagtgtgtt tgtgagctca ttaacaggct ttcagtatgt agctgaaatt tgctgtgtag
    10081 accagacagg cctcaaattt gtggcaatcc tccctgcatc ttcccagaat gccctggtac
    10141 aggcataaac caccgtgccc agcagtaaaa caatctggtg aggtattatt agtcgtgtgc
    10201 tgtgacccag aaaccccact cctggcaatt tactgggaag gaacaaacaa agggctaggg
    10261 gagccatatg gcctgcagtt agagaaaatt agatccaact gaaaaatcaa cctaaaggtg
    10321 taaaagccaa gcagttaaga aactgacagg ctcatgatgg aagccgaggc catcgtgaac
    10381 actcttcatt ttaggcccca cgtatcactg gggacaactg agagtcaaag tacaggtaag
    10441 gagaccaagg cttttcagga ctcaggctgt ctcagtgaaa agcccagaag agcagtaatt
    10501 gaaagagctc agacgatgtg tctgatctcc tctgtttgtt tgttgctgta ttatttccac
    10561 taacttattt gggaggaaaa aaaacagttc acaggcttct tttcttgaaa tactggggat
    10621 tgctgggatc gaacccaggg ataggttttt agtttctaaa ataacataga tcatgccctg
    10681 tttgcttttt ggaatatgtt tgcgctgccc ttattttcat gttcaaatac tgctccattt
    10741 tgcgtgactc tttagtattg gtttgatgat ttgcatatta gattagattg tatttcagtt
    10801 ctcagactta tttatcaatt ctagttttct ctttttgttg ttttaaagga ctcctgagta
    10861 tatttcagaa ctgaaccatt tcaaccgagc tgaagcattc tgccttccta gtggtaccag
    10921 tccaatttag gagagccaag cagactgtga gtgccctgtg aatcatgatg gtcttgggga

D50092 Rat 2832-2878 5109-5206            
Query: 1    caatctggtgaggtattattagtcgtgtgctgtgacccagaaaccccactcctggcaatt 60
            ||||||||||||||||||||||| |  ||||||||||||||||||||||| |||||||||
Sbjct: 4436 caatctggtgaggtattattagttgcatgctgtgacccagaaaccccacttctggcaatt 4495

     4081 ccccccccca tcccctctca ttcacattta gaaaggagaa aactgctacc catgtctggc
     4141 atttatttca gagattaact gtgcaaaact cgatgtgaaa gtatactatt ctgtttccca
     4201 gtcacactta gttgacagtg taagtcagta agggctttgg ttggttggtt tggttggttg
     4261 gttcctgggt tagtctggat gtgcttgttg agagctcaat aacaggcttt caatatggat
     4321 atgtagctgg gaattcgcta tgtagaccag gcaggcctca aatttgtggc aatcctccct
     4381 gtgattcccc agaatgccct ggtacaggca taagccactg tgcccagccg taaaacaatc
     4441 tggtgaggta ttattagttg catgctgtga cccagaaacc ccacttctgg caattcacct
     4501 gccgtggtgg aaccaacaaa gggctagggg agccatatgg ccaacagtta cagaaaatta
     4561 gatccaaggg aaaagcaacc taaatgttta acaggcgagc agctaagaaa ctgacaggct
     4621 cgtgagggag ctgtagcaat cccgaagaac actcttcatt ttagactcca tgtatccctg
     4681 ggaaaaacag agtcaaagta caggttagga gaccgggact cctctggacc catgctgtcc
     4741 tctgaaaagc ccagaagagc tataatgaaa gagctcagaa gatgtctgat cttggctttc
     4801 tttatgtttg ttgctgtatt gtttccacta acaaacaact aaaaaaaaaa aaaaagttca
     4861 caggcttctt tccttaaaat actggggatt gaacccaggg atagtttttt agtgtctaaa
     4921 ttaacatgac catgccctgt ttgccttttt ggagtatgtt tgaatctgcc cttatttcca
     4981 ttctcaaata ctgctccatt ttatatgact atttagtttt ggcttgataa tttgcatatg
     5041 agattagatc atctttcagt tctcagactt atttatcaat tctagttttt ctttttgttg
     5101 ttttaaagga ctcctgaata tatttcaaaa ctgaaccatt tcaacccaac tgaagtattc
     5161 tgccttctta gcggtaccag tccggtttag gagagccaag ccgactgtaa gtgccctgtg

sheep 5666-5717 8139-8236
     7261 atttatggaa taaaatacaa atcaaagcaa gtctggatta tcgttttaca actactagta
     7321 aaaacagtaa cagcaaccac tcctggaagg ttacctagaa atttgcatat tcgtttatgt
     7381 gaggtggcaa ggctttggag ttagaaatat ggctctgcag ctaattttac aatttgggac
     7441 ctaatttcgt catcgtcctt ttgtccattt ataaaataga ggaaattata cctacttcag
     7501 gagtttgcca agattaactg tgtaaaactg acctttagca tgtatacatt tattctttcc
     7561 ctagtcacac tgcactgggg gacatttgtg aatctatgaa atttgtgaaa aatggatcct
     7621 ttaagccatg accctgaaac cccactcctg ggaacttacc tgcaatggaa gaaattcgga
     7681 aagaagaaaa gctgcattca cccacagggc tcagaatgat ctaaaattag atccagtcca
     7741 gagacaacct aaaggtatta agaaaatagc agggcagcag ctaagaaaat catagcactt
     7801 taactgaaag gaacattgtg taacccatca cgtggcataa ttttagagcc tctctgtgat
     7861 atataggaaa aaagtgacag gtcaaagtaa gattactcag acatggatgc atatgtggaa
     7921 aatctgaata aaaaatggac ccacagtttt ctgtgtatgg gaggagagtt cagtgtcatg
     7981 tttgctgctt ttttttagtc agcgtcatct cttttaaaaa tactatcata tttttttcct
     8041 tgagtagatt cattagtggt ttaataattt atatactgtt attctattaa ataatccgtt
     8101 cttagattta tcaattatag tttgtttttt tttttaagga cttctgaata tatttgaaaa
     8161 ctgaacagtt tcaaccaagc tgaagcatct gtcttcccag agacacagat ccaacttgag
     8221 ctgaatcaca gcagatgtag gtacctgcgg aatctctctg gtcttgtgat ggttgaaagt

U78769 golden hamster
     intron  1       <1..177
     exon  2          178..276
     intron  2        277..>492
     
        1 gaacgtgcca tgtttgcttt tgggaatcta tctgagctgt tcttatttcc gttttcaaat
       61 actgccccat ttttatgtgc ctgtatttat tagtggtttg gtaatttgta tattagatgg
      121 tatttcagta cttagattta ttcatcaatt ctaatttttc tttttcatgt tttgaaggac
      181 tcctgaatat attccaaaac tgaacaattt caactgagct gaagtactct gtttttctag
      241 aggtaccagt tcagtttagg agagtcacag cagatcgtaa gtgccctgtc aatcttggta
      301 gagggcttga aaatctccaa ctgtctgggg agatggggac cagaaaagac taagctccac
      361 acttgctcca gaggctccta gtaacgtggg acataagcct tgctgtgcac taatgtcctg
      421 taaagtcagc tttgtccagg ggacaaaggc cagagctttc tctaggactg tgccggttta
      481 gggaactgca ag



>ra	2832	2878	5109	5206
>mo	8612	8658	10849	10946	28680	30687
>ha	333	342	349	351	354	410
>hu	12634	12767	15390	15488	25464	27817)
>sh	5666	5717	8139	8236	22268	26295
>co		803	855		3298	3395

	exon 1	intron 1	exon 2

>rat	47	2230	98  83% identical to mouse over intron 1
>mouse	47	2190	98  539 bp in 3 retrotransposons in intron 1
>hamster	57	-	98
>human	134	2622	99  only last 180 bp related to cow in intron 1, 353 bp in 3 retrotransposons
>sheep	52	2421	98  91% identical to cow over intron 1
>cow	53	2442	98

Though the prion gene is chock-full of retrotransposons, there are no recognizable ones here except for 3 each in human  and mouse intron 1: 

>mouse intervening repeats in region of exon 1-2
     repeat_region   7980..8069 PB1D7 
     exon 1             8612..8658
     repeat_region    9619..9844 B3 = 226 bp
     repeat_region    10044..10163 B1-F = 120 bp
     repeat_region    10070..10163 PB1D7 = 193 bp
     exon 2           10849..10946

>human intervening repeats in region of exon 1-2 
     repeat_region   11478..11800 AluJo
     exon 1          12634..12767
     repeat_region   14413..14498 L1MC1  = 86 bp
     repeat_region   14583..14653 MIR    = 71 bp
     repeat_region   14752..14947 L1ME3 = 196 bp
     exon 2          15390..15488

>sheep intervening repeats in region of exon 1-2
     repeat_region    3756..4215 MLT1F
     exon 1           5666..5717
     exon 2           8139..8236
 



>She  gaaatttgtgaaaaa---------------tggatcctttaagccatgaccctgaaaccccactcctgggaacttacctg-caat--ggaagaaattcggaaagaagaa--
>Bov  gaaatttgtgaaaaa--------cagtcaggtgatcctttaagccatgaccctaaaaccc-actcctgggaacttacctg-taat--ggaggaaaccaggaaagaagaaga
>Hom  acattttgttaagcaatctggtgatgcattaagaagctggaagctgtgacccagaaaccccactcctgagaacttacctg-caat--ggaagaaacaaacaaacaaaaac-
>Mus  cccagcagtaaaacaatctggtgaggtatta-ttagtcgtgtgctgtgacccagaaaccccactcctggcaatttac-tgggaa---ggaacaaacaaagggctagggg--
>Rat  cccagccgtaaaacaatctggtgaggtatta-ttagttgcatgctgtgacccagaaaccccacttctggcaattcacctgccgtggtggaaccaacaaagggctagggg--

>She  -aagctgcattcacccacagggctcagaatgatctaaaattagatccagt-ccagagacaacctaaaggtattaagaaaatagcagggcagcagctaagaaaatcatagcactttaa
>Bov  aaagctgcattcacccacagaactcagaatgatctaaaattagatccagt-ccggagtcaacctaaatgtattaataaaatagcagggcagcagctaagaaaatcatagcactttaa
>Hom  aggcatgtattcc----tag----cagaatgatctaaaattagaacacctggaaaag--agcctaaatgtat------aacaccagggcagtagctaagaaaattatgacacattaa
>Mus  agccatatggcctg----------cagttagag--aaaattagatccaactgaaaaatcaacctaaaggtgt------aaaagccaagcagt---taagaaact---gaca--ggct
>Rat  agccatatggccaa----------cagttacag--aaaattagatccaagggaaaag-caacctaaatgttt------aacaggcgagcagc---taagaaact---gaca--ggct



>She  ctgaaaggaacattgtgtaacccatcacgtggcataattttagagcctctctgtgatatataggaaaaaagtgacaggtcaaa--gtaag---attact----cagacatggatgcatatgtggaaaatctgaa
>Hum  ctgaaatgaacattatgtaaccactaaaaat-catgattttggagcct----gtgatatgtggggaaaaactgacaagtaaaaaagtgggttattaactgcacctgcttactctaacgtgaacgcatatgtgaa
>Bov  ctgaaaggaacattgtgtaacc-atcacgagtcataattttagagcctctctgtgatatacaggaaaaaactgacaggtcaaa--gtaag---attact----cagacatggatgcgtttgtggaaaatctgaa



>She  taaaaaatggacccacagttttctgtgtatgggaggagagttcagtgtcatgtttgctgcttttttttagtcagcgtcatctctttt--aaaaatactatcatatttttttccttgagtagattcattag
>Bov  tgaaaaatgaatccacagtttgctgtgtatgggaggagagttcagtgtcacgtttgctgctttttttaagttagcatcatctcttttttaaaaatactatcatatttttt-ccctgagtagattcattag
>Hum  aaatctgaaaggaaaagcacagaaaatggacgttttcattgaaattgtcggtgatcttaattttcctttggtgaatatattgctctcactaagggcgtttaaaaaatagttcacaggttttaatttttt
>Hum  agatgaaatggacccacagttttctgtaagagaaaggagagattgttatatttgctacttagaataaaagatttttagccaacgttgtttcctttttcaaatatttttccatttttttagttgattaat







>Mus  catgatggaagccgaggccatcgt--gaacactcttcattttaggccccacgtatcactggggacaactgagagtcaaagtacaggtaaggagaccaaggcttttcaggactcaggctgt-ctcagtgaa
>Rat  cgtgagggagctgtagcaatcccgaagaacactcttcattttagactccatgtatccctgggaaaaac--agagtcaaagtacaggttaggagaccgggactcctctggacccatgctgtcctc--tgaa

>Mus  aagcccagaagagcagtaattgaaagagctcagacgatgtgtctgatct----cctctgtttgtttgttgctgtattatttccactaacttatttgggagg--aaaaaaaacagttcacaggcttcttt
>Rat  aagcccagaagagctataat-gaaagagctcagaagatgt--ctgatcttggctttctttatgtttgttgctgtattgtttccactaac-aaacaactaaaaaaaaaaaaaaagttcacaggcttcttt

>Mus  tcttgaaatactggggattgctgggatcgaacccagggataggtttttagtttctaaaataacatagatcatgccctgtttgc-tttttggaatatgtttgcg-ctgcccttattttcatgttcaaat
>Rat  ccttaaaatactggggatt--------tgaacccagggata-gtttttagtgtctaaattaacat-gaccatgccctgtttgcctttttggagtatgtttgaatctgcccttatttccattctcaaat
>Ham  ..................................................................gaacgtgccatgtttgc-ttttgggaatctatctgag-ctgttcttatttccgttttcaaat

>Hum  .......................................gatttagtaatttgtgtattgggtttttttaagaatcagttcttagattcatttatcaattctagttttttgttgttgtttttaag

>She  ....................................tggtttaataatttatatactgttattctattaaataatccgttcttagatttatcaattatagtttgt---tttttttttt---aag
>Bov  ............................tggtttaataatttatatactgttattctgttaaataatccgttcttagatttatcaatt-atagtttt----ttcttttttttttaagg
>Mus  actgctccattttgcgtgactctttagtattggtttgatgatttgcatattag----attagattgtatttcagttctcagacttatttatcaattctagttttctctttttgttgttttaaagg
>Rat  actgctccattttatatgactatttagttttggcttgataatttgcatatgag----attagatcatctttcagttctcagacttatttatcaattctagttttt-ctttttgttgttttaaagg
>Ham  actgccccatttt-tatg--tgcct-gtatttattag-tggtttggtaatttgtat-attagatggtatttcagtacttagatttattcatcaattctaattttt-ctttttcatgttttgaagg
-

exon 1b's

>Ham 411-810
gtaagcggct
      421 tctgaagcct ggccccggga agggtgctgg agccaggcct cggtaagcct tcggcttccc
      481 agagccaagc ccggcttact ccggctctcg gggcgctgag gccgcggggc tgaggttgag
      541 tctggctggg aggtgaccgc gcacccgcag ccgcgcgtct ccttgaggga ccgaacccca
      601 ggagaggcca ggagccatcc cttcctcccg agcccggctc acccccagag tcgctcgggg
      661 atgggggatg ggggatgggg tggcatcttt tgactgtcgt ttgctgtttt cttctctctt
      721 tgtaatagct acagcgaaca taattttacc cagggttcca ccgtggtctc gtccgtcctc
      781 ggcatctctc agtccagtac atacccaagg
>Mus 
t aagcgggctg ctgaagccag gccttggcga gcactcagcc
     8701 ttccgtcgtc aagctcggct cactgcgcct ctcggggcct tgaggccacg gggactagga
     8761 ctgggactgg gactggggct gagtctggct gggaggtgac tgtacacccc ctgtgcgcga
     8821 ctcctggagg aaccgaatcc cagggcagcc aggccgggag ccagcctttc cttcccgagc
     8881 cagattcaca gctcagcatc gctggggatg ggggtggcat cttttgactg tccttggctg
     8941 ttttcttctc tctttgtagt agctacagcg aacataattt tacctcgtta ttccaccaca
     9001 gtcattactc ccttgcacag tttcattctc aacgtcgccg tgcgccttca ctgccctgtc
     9061 taggcgtttt catgattgt                
>Rat
gt
     2881 aagcgggctg ctgaagccag gcgtcagcga gcattcagcc ttcctcccgt cgacaagctc
     2941 ggcttactgt gcctctccgg gacttgaggc cgcggggctg ggactggggt tgagcttggc
     3001 taggaggtgg ctgtgcaccc gctgtgcgcg actcctggag ggaccgaatc ccagggcagc
     3061 gaggccggga gccgagcctg attcacagct caacatcgct gtgggggatg gggggttggg
     3121 ggggtggcat cttttaactg ccctgtgctg ttttcttctc tcgttgtaat agctacagcg
     3181 aacataattt caccccgtga ttccaccacg gtctcatccg tcctcagcac cacactcatt
     3241 gctccccttg ctcagtttca tactcagcgc agccgttcgc cttcactgcc ctgcctag
>cow 1b  856-
gtaaa tagccgcgta gtcctttaaa ctcccagcgg aggacgccaa
      901 ccctgggtct tgcggccgag gcccagggac ccagccgaat cggattggtg ggaggcagac
      961 cttgaccgtg agtagggctg ggggcttgcg gcgggcgcgg ggaacgtcgg gcctgttgag
     1021 cgtgctcgtt ggtttttgcc agccgccgct cggttttacc ctcctggtta ggagagctcc
     1081 atttactcgg aatgtgggcg ggggccgcgg ctggctggtc cccctcccga ggtatgtggg
     1141 tggtgtgtag gaatc
>She 5718-
gta aatagccacg tagtccttta aacccccagc ggaggccgcc
     5761 cccggcttgc ggccgaggcc ctagggcact cagccggatc ggactggctg ggaggcagac
     5821 cttgaccgtg aggaggactg ggggcttccg gcgggcgcgg ggaacgtcgg gcctgtttag
     5881 cgtgctcgtt ggtttttgcc agccaccgct cggttttgcc ctcctggtta ggagagctcc
     5941 atttactcgg aatgtgggcg ggggccgcgg ctggctggtc cccctcctga agtatgtggg
     6001 tggtgtgtag gaatcta
>hum
gta aacgcccggg
    12781 gtgggaggaa cgcgggcggg ggcaggggag ccgcgggggc cgagtgagga ccccgggcct
    12841 cgggtcccag gcgcaagggt gcccggccgg gcggggtcgg gaccccagtg aggaggggcc
    12901 gggggctgcc ccgcgggcgc gtgacggtct cgggcctgcc cggctgcgct ggtctccgct
    12961 cgggtgaggc ggcttggctt cgcttttcag gttaggaaag ctccctttac tgcgcgttgg
    13021 ggggctgggg gagctggcgg agccacgtta gggaggtcgg tggcgccggg gtgtctcagc
    13081 gccccctgca ccccgcgcgg gtccggccca gcgggcgatc gctggcgccc agggaactcc
    13141 gggagggccg ccagcgggct ccgcaggcgc ggggcgggga ggggcgc



cow: 1    gtaaatagccgcgtagtcctttaaactcccagcggaggacgccaaccctgggtcttgcgg 60
          |||||||||| ||||||||||||||| ||||||||||| ||||   || ||  |||||||
she: 5718 gtaaatagccacgtagtcctttaaacccccagcggaggccgcc---cccgg--cttgcgg 5772

    
Query: 61   ccgaggccc-aggg-acccagccgaatcggattgg-tgggaggcagaccttgaccgtgag 117
            ||||||||| |||| || |||||| |||||| ||| ||||||||||||||||||||||||
Sbjct: 5773 ccgaggccctagggcactcagccggatcggactggctgggaggcagaccttgaccgtgag 5832

    
Query: 118  tagggctgggggcttgcggcgggcgcggggaacgtcgggcctgttgagcgtgctcgttgg 177
             ||| |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 5833 gaggactgggggcttccggcgggcgcggggaacgtcgggcctgtttagcgtgctcgttgg 5892

    
Query: 178  tttttgccagccgccgctcggttttaccctcctggttaggagagctccatttactcggaa 237
            |||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 5893 tttttgccagccaccgctcggttttgccctcctggttaggagagctccatttactcggaa 5952

    
Query: 238  tgtgggcgggggccgcggctggctggtccccctcccgaggtatgtgggtggtgtgtagga 297
            ||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||
Sbjct: 5953 tgtgggcgggggccgcggctggctggtccccctcctgaagtatgtgggtggtgtgtagga 6012

               
Query: 298  atc 300
            |||
Sbjct: 6013 atc 6015

>cow 1b  856-
gtaaatagccgcgtagtcctt taaactcccagcggaggacgccaaccctgggtctgcggccgaggcccagggacccagccgaatcgga ttggtgggaggcagaccttgacc
gtgagtagggctgggggctt gcggcgggcgcgggg.flanker 

Multalin version 5.3.3

     150
Ham  GTAAGCGGCT TCTGAAGCCT ...GGCCCCG GGAAGGGTGC TGG..AGCCA
Mus  .......... .......... ........TA AGCGGGCTGC TGA..AGCCA
Rat  .......... .......... .......GTA AGCGGGCTGC TGA..AGCCA
hum  GTAAACGCCC GGGGTGGGAG ...GAACGCG GGCGGGG.GC AGGGGAGCCG
cow  GTAAATAGCC GCGTAGTCCT TTAAACTCCC AGCGGAG.GA CGCCAACCCT
She  GTAAATAGCC ACGTAGTCCT TTAAACCCCC AGCGGAG.GC CGCC..CCCG
           Consensus  gtaaa..gcc .cg.ag.cct ....acccc. aGcgGgg.Gc .G...agCC.


gtaaatagccacgtagtcct 
gtaaatagccgcgtagtcctt taaactcccagcggaggacgccaaccc
tgggtctgcggccgaggcccagggacccagccgaatcgga ttggtgggaggcagaccttgacc with flanker gtgagtagggctgggggctt gcggcgggcgcgggg.

       Comparison of bovine exon 1b - intron 1 junction to other species
								  	                112

     51               100
Ham  CGGTAAGCCT TCGGCTTCCC ....AGAGCC AAGCCCGGCT TACTCCGGCT
Mus  TGGCGAGCAC TCAGCCTTCC ....GTCGTC AAGCTCGGCT CACTGCGCCT
Rat  CAGCGAGCAT TCAGCCTTCC TCCCGTCGAC AAGCTCGGCT TACTGTGCCT
cow  GGGTCTTGCG GCCGAGGCCC ....AGGG.. A..CCCAGCC GAATCGGATT
She  G...CTTGCG GCCGAGGCCC ....TAGGGC A..CTCAGCC GGATCGGACT
           Consensus  ggg.cttgcg gCcGaggcCC ......gG.c A..CtCaGCc gaaTcgGacT

     101              150
Ham  CTCGGGGCGC TGAGGCCGCG GGG....... .......... ..CTGAGGTT
Mus  CTCGGGGCCT TGAGGCCACG GGGACTAGGA CTGGGACTGG GACTGGGGCT
Rat  CTCCGGGACT TGAGGCCGCG GGG....... ......CTGG GACTGGGGTT
cow  GG.TGGGAGG C.AGACCTTG A......... .......... ..CCG....T  gga ttggtggg
She  GGCTGGGAGG C.AGACCTTG A......... .......... ..CCG....T
Con  ggctGGGagg c.AGaCCttG a......... .......... ..CcG....T

     151              200
Ham  GAGTCTGGCT GGGAGGTGAC CGCGCACCCG CAGCCGCGCG TCTCCTTGAG
Mus  GAGTCTGGCT GGGAGGTGAC TGTACACCCC CTGT.GCGCG ACTCCTGGAG
Rat  GAGCTTGGCT AGGAGGTGGC TGTGCACCCG CTGT.GCGCG ACTCCTGGAG
cow  GAGTAGGGCT GGGGGCTTGC GGCGGGCGCG GGGA.ACGTC GGGCCTGTTG
She  GAGGAGGACT GGGGGCTTCC GGCGGGCGCG GGGA.ACGTC GGGCCTGTTT
Con  GAGtagGgCT gGGgGcTt.C gGcgggCgCg ggGa.aCGtc gggCCTgttg



-=-=-=-=-=-=-=-=-=-=-=-=-=-=-
>Consensus  
gtaaatagcc gcgtagtcct ttaaactccc aGcgGagGa cGCCacCct
gggtcttgcg gCcGaggcCC aggGc ACtCaGCc gaaTcgGacT
ggctGGGagg cAGaCCttG aCcGT
GAGtagGgCT gGGgGcTtgC gGcgggCgCg ggGaaCGtc gggCCTgttg
agcgtGctcg ttgGtttttg ccaGccgccg ctCggtttTa ccctcCtggt
taggagagCt ccatttactc gGaATgtggG cggggGccgc GGcTGGC
TggTccCcct CctgaggTaT gTgggTggtg tgTaGgAaTC

Comparison to human
          1                                                   50
                 cow  GTAAATAGCC GCGTAGTCCT TTAAACTCCC AGCGGAGGAC GCCAACCCTG
                 She  GTAAATAGCC ACGTAGTCCT TTAAACCCCC AGCGGAGGCC GCC..CCCGG
                 hum  GTAAACGCCC GGGGTGGGAG GAACGCGGGC GGGGGCAGGG GAGCCGCGGG
           Consensus  GTAAAtagCC gcGtaGtcct ttAaaC.ccC aGcGGagG.c Gcc..cCcgG

                      51                                                 100
                 cow  GGTCTTGCGG ...CCGAGGC CCAGGG..AC CCAGCCGAAT CGGA..TTGG
                 She  ...CTTGCGG ...CCGAGGC CCTAGGGCAC TCAGCCGGAT CGGA..CTGG
                 hum  GGCCGAGTGA GGACCCCGGG CCTCGGG.TC CCAGGCGCAA GGGTGCCCGG
           Consensus  gg.CttGcGg ...CCgaGGc CCt.GGg.aC cCAGcCG.At cGGa..ctGG

                      101                                                150
                 cow  .TGGGAGGCA GACCTTGACC ...GTGAGTA GGG.CTGGGG GCT.TGCGGC
                 She  CTGGGAGGCA GACCTTGACC ...GTGAGGA GGA.CTGGGG GCT.TCCGGC
                 hum  CCGGGCGG.. GGTCGGGACC CCAGTGAGGA GGGGCCGGGG GCTGCCCCGC
           Consensus  ctGGGaGGca GacCttGACC ...GTGAGgA GGg.CtGGGG GCT.tcCgGC



Mad Cow Home ... Best Links ... Search this site