Odd prion allele found in goat
Impaired motor coordination in mice lacking prion protein.
Beyond Medline: searching full-text of many journals for CJD keywords
Am Soc Cell Biology meeting Dec. 12-16, 1998, San Francisco, CA
New web site and Latest publications at Anderson's group
14-3-3 test now offered in Belgium
Mini-review: The Yeast Psi+ Prion: Making Sense of Nonsense
Similarities between BSE and an isolate of natural scrapie, CH1641
Ubiquitinated inclusions in prion diseases
9 Jan 99
J Gen Virol 1998 Dec;79 (Pt 12):3173-6 Full-text online for a trial period soon . Goldmann W, Chong A, Foster J, Hope J, Hunter N Fax +44 131 668 3872"The prion protein (PrP) gene modulates the incidence and incubation periods of transmissible spongiform encephalopathies of sheep, goats, mice and man. Here, a new caprine PrP allele encoding the shortest naturally occurring PrP protein so far described is reported. This variant contains only three instead of the usual five copies of a short peptide repeat [Pro-Gln/His-Gly-Gly-Gly-(Gly)-TrpGly-Gln] characteristic of PrP, with an additional Trp to Gly substitution in codon 102. Fifteen out of 111 genotyped goats carried the novel PrP allele and 14 survived without signs of disease for at least 4 years. One goat heterozygous for the polymorphism was challenged experimentally with SSBP/1-scrapie and succumbed after an unusually long incubation period."
Comment (webmaster):
The allele is remarkable, in part because it is two unusual mutations, a double deletion coupled with a point transversion. The lack of disease is no real surprise in part because 4, 5, or 6 repeats seem to function adequately in other species and because of prior studies of transgenic deletions through codon 91. Reduced susceptibility makes sense under the like-like principle when challenged by a rather different sheep sequence for the single heterozygous goat tested.
The 102 numbering refers to the wildtype allele, WNKPSKPKTNMKHVAGAAAAGA, whereas the CJD mutation P102L is 3 residues later. Three earlier GenBank goat entries have canonical 5-repeat regions [below].
The 3 repeat allele plus W102G was found in "3 Siberian goats, 11 of their offspring; and a single British dairy goat" all of which were heterozygotes. The authors kindly provided further details not in the paper:
The Siberian goats in question originated about 10 years ago as imported embryos from Gorno-altai in Siberia for wool studies; these goats are bred in Siberia for wool production. Goats bred from these embryos were acquired for the experiment here. It is not resolved whether they are domesticated goats from Siberia, rather than Siberian goats, a wild species different from domestic goats. It is possible that the latter are kept for wool without really being domesticated, on the order of alpacas and vicunas.
It does not seem possible that a bizarre double mutation or rare allele could have arisen twice in such a small sample of goats: probably the dairy goat and Siberian goat shared a very recent ancestor through uncontrolled breeding. Alternately, this could be a fairly widespread, if uncommon, polymorphism in caprids.
The goats lived on the NPU farm until they died; one is still alive and healthy. They would almost certainly have originated from the same herd and may be related through a common sire. The British Dairy goat was basically just a British dairy goat -not really a breed. Breeding 3/3 homozygotes has been slow because the male 3/5's had already been fixed or used for scrapie challenge experiments and ineligible for breeding. Since Aa x Aa or Aa x AA give half heterozygotes and aa x AA gives all heterzygotes but was ruled out, the finding of 11/11 Siberian offspring suggests, but does not prove, lethality of (3:3).
Siberian goats are a wild species that is hunted near Lake Baikal, Capra sibirica [alternately, Capra ibex sibirica or Capra ibex subsp. sibirica ]. These taxonomic designations fit published mitochondrial control region DNA sequences better than placement of Siberian goats as a breed of Capra hircus. Thus even though the provenance of the goats used is murky, their affinities could still determined.
The two mutations have not been seen separated through recombination. They could be lethal in the homozygous state either together or separately. W102G by itself should fail to have a full gamut of normal function because it is an absolute invariant in all species including birds.
Double deletions for internal repeats are expected from the DNA slippage model and were predicted at this site years ago. The actual end points of the deletion event can only be determined up to an ambiguity zone (deleting any contiguous 48bp gives the same end result) using third codon redundancy. Goat prion has a sizeable ambiguity zone for this R2-R3 deletion as shown below [webmaster]:

The real issue is normal function. The 102 mutation is doubly severe: a non-conservative amino acid substitution at a codon conserved for over 310 million years in all species. Unfortunately, there is no assay for normal function. It is just barely possible that the deletion and point mutation are compensatory and that the remaining repeats suffice to bind one molecule of copper or zinc and still function adequately. Assuming that this is a normal haplotype in wild Siberian goats, the allele must be evolutionarily acceptable in this species.
The authors came across a single animal with this allele during a earlier study, J. Gen. Virology 77: 2885 1996, but lacked time to pursue the issue; the animal was not included in the data of experiment J of that study. A partial gene sequences of goat PrP exon and the promoter region also mentioned there has not been finished by 20 Jan 99 and is unsuittable even as preliminary data: goat scrapie is not a significant issue in the UK (unlike Cyprus). This is too bad because there are enormous advantages in having 3 sequences instead of two [cow, sheep] in reconstructing the evolution of upstream regions of the prion gene in artiodactyls and in turn, in all mammals.
The 1996 study also found three missense alleles, two silent polymorphisms, and a RFLP polymorphism, making 8 alleles when the 1998 paper is included. GenBank is not up-to-date so these alleles and reference fasta sequences are compiled below.

The S240P goat polymorphism illustrates a very interesting feature of non-disease polymorphisms in the prion gene vis-a-vis inter-specific differences, namely, that for codon positions where the same amino acid substitution has ocurred in various lineages, that same substitution will also occur within a single species as a polymorphism if enough individuals are examined. This scaling principle, which somewhere must have a name, is applicable to highly conserved genes: the near-neutral polymorphisms are also the plesiomorphisms and local synapomorphies.
The relationship is not quantitative without averaging in forward direction because of genetic drift causes swings in allele frequencies within individual taxa. The polymorphism probably passes through speciation events with similar shifts in frequencies.
In the case of S240P, 59 goats showed pro/pro, pro/ser, ser/ser at 44%, 42%, and 14% resp., quite close to Hardy-Weinberg equilibrium (42%, 46%, 12%) for the 65/35 split of pro/ser alleles. In other words, the "wildtype" goat has proline at position 240 but only at a 2:1 ratio. If only a single animal had been sequenced, which is unfortunately often the case, an accepted point mutation might have been inferred. This sampling effect causes rates of evolution to be over-stated. A protein is better described by a 1x20 frequency matrix for the 20 amino acids; this matrix is poorly estimated by sequencing a single animal.
Proline occurs at codon 240 in mink, polecat, dingo, and domestic dog (but not cat); otherwise the FSSPP region is strictly invariant in mammals, even though it begins 3 positions downstream from the GPI cleavage site (thought by some to imply lack of importance). The human CJD mutation M232R also occurs downstream at MVLFSSPPVI
N171S is another such pair. For this reason it is unlikely to be causal for CJD as sometimes asserted. Chimpanzee, orangutan, siamang, and malayan gibbon are S; all other species including gorilla and human are N. The principle above predicts the observed N171S allele in humans and the unobserved polymorphism in gorillas as well as asparagine alleles in the other great apes.
Breeds used in the goat sequencing studies are:
-- The British Alpine was developed in Great Britian in the early 1900s.
-- The Saanen dairy goat originated in Switzerland, in the Saanen Valley.
-- The Toggenburg is a Swiss dairy goat from Toggenburg Valley of Switzerland at Obertoggenburg; they are also credited as being the oldest known dairy goat breed.
-- Anglo-Nubians were developed in England by crossing British goats with bucks of African and Indian origin.
-- The Angora goat originated in the district of Angora in Asia Minor. The Angora dates back prior to early biblical history. Mention is made of the use of mohair at the time of Moses, which would fix the record of the Angora some time between 1571 and 1451 B.C., according to the Angora Goat Mohair Industry publication from USDA (Miscellaneous Bulletin 50, 1929).
The goat site at Oklahoma State says that, "unlike sheep, goat ancestry is fairly clear. The major contributor of modern goats is the Bezoar goat which is distributed from the mountains of Asia Minor across the Middle East to Sind. Unlike sheep, goats easily revert to feral or wild condition given a chance. In fact, the only domestic species which will return to a wild state as rapidly as a goat is the domestic cat.
Capra
Capra aegagrus(wild goat)
Capra caucasica
Capra cylindricornis
Capra falconeri
Capra hircus(goat)
Capra ibex
Capra ibex ibex
Capra ibex nubiana
Capra nubiana
Capra pyrenaica
Capra sibirica [or Capra ibex sibirica or Capra ibex subsp. sibirica].
>X91999 Capra hircus prp gene, Anglo-Nubian breed of goat atggtgaaaagccacataggcagttggatcctggttctctttgtggccatgtggagtgac M V K S H I G S W I L V L F V A M W S D gtgggcctctgcaagaagcgaccaaaacctggcggaggatggaacactggggggagccga V G L C K K R P K P G G G W N T G G S R tacccgggacagggcagtcctggaggcaaccgctatccacctcagggagggggtggctgg Y P G Q G S P G G N R Y P P Q G G G G W ggtcagccccatggaggtggctggggccaacctcatggaggtggctggggtcagccccat G Q P H G G G W G Q P H G G G W G Q P H ggtggtggctggggacagccacatggtggtggaggctggggtcaaggtggtagccacagt G G G W G Q P H G G G G W G Q G G S H S cagtggaacaagcccagtaagccaaaaaccaacatgaagcatgtggcaggagctgctgca Q W N K P S K P K T N M K H V A G A A A gctggagcagtggtagggggccttggtggctacatgctgggaagtgccatgagtaggcct A G A V V G G L G G Y M L G S A M S R P cttatgcattttggcaatgactatgaggaccgttactatcgtgaaaacatgtaccgttac L M H F G N D Y E D R Y Y R E N M Y R Y cccaaccaagtgtactacagaccagtggatcagtatagtaaccagaacaactttgtgcat P N Q V Y Y R P V D Q Y S N Q N N F V H gactgtgtcaacatcacagtcaagcaacacacagtcaccaccaccaccaagggggagaac D C V N I T V K Q H T V T T T T K G E N ttcaccgaaactgacatcaagataatggagcgagtggtggagcaaatgtgcatcacccag F T E T D I K I M E R V V E Q M C I T Q taccagagagaatcccaggcttattaccaaaggggggcaagtgtgatcctcttttctccc Y Q R E S Q A Y Y Q R G A S V I L F S P cctcctgtgatcctcctcatctctttcctcatttttctcatagtaggatag P P V I L L I S F L I F L I V G - >X74758 Capra hircus, also Anglo-Nubian breed of goat atggtgaaaagccacataggcagttggatcctggttctctttgtggccatgtggagtgac M V K S H I G S W I L V L F V A M W S D gtgggcctctgcaagaagcgaccaaaacctggcggaggatggaacactggggggagccga V G L C K K R P K P G G G W N T G G S R tacccgggacagggcagtcctggaggcaaccgctatccacctcagggagggggtggctgg Y P G Q G S P G G N R Y P P Q G G G G W ggtcagccccatggaggtggctggggccaacctcatggaggtggctggggtcagccccat G Q P H G G G W G Q P H G G G W G Q P H ggtggtggctggggacagccacatggtggtggaggctggggtcaaggtggtagccacagt G G G W G Q P H G G G G W G Q G G S H S cagtggaacaagcccagtaagccaaaaaccaacatgaagcatgtggcaggagctgctgca Q W N K P S K P K T N M K H V A G A A A gctggagcagtggtagggggccttggtggctacatgctgggaagtgccatgagtaggcct A G A V V G G L G G Y M L G S A M S R P cttatacattttggcaatgactatgaggaccgttactatcgtgaaaacatgtaccgttac L I H F G N D Y E D R Y Y R E N M Y R Y cccaaccaagtgtactacagaccagtggatcagtatagtaaccagaacaactttgtgcat P N Q V Y Y R P V D Q Y S N Q N N F V H gactgtgtcaacatcacagtcaagcaacacacagtcaccaccaccaccaagggggagaac D C V N I T V K Q H T V T T T T K G E N ttcaccgaaactgacatcaagataatggagcgagtggtggagcaaatgtgcatcacccag F T E T D I K I M E R V V E Q M C I T Q taccagagagaatcccaggcttattaccaaaggggggcaagtgtgatcctcttttctccc Y Q R E S Q A Y Y Q R G A S V I L F S P cctcctgtgatcctcctcatctctttcctcatttttctcatagtaggatag P P V I L L I S F L I F L I V G - >S82626 African dwarf goat 771bp atggtgaaaagccacataggcagttggatcctggttctctttgtggccatgtggagtgac M V K S H I G S W I L V L F V A M W S D gtgggcctctgcaagaagcgaccaaaacctggcggaggatggaacactggggggagccga V G L C K K R P K P G G G W N T G G S R tacccgggacagggcagtcctggaggcaaccgctatccacctcagggagggggtggctgg Y P G Q G S P G G N R Y P P Q G G G G W ggtcagccccatggaggtggctggggccaacctcatggaggtggctggggtcagccccat G Q P H G G G W G Q P H G G G W G Q P H ggtggtggctggggacagccacatggtggtggaggctggggtcaaggtggtagccacagt G G G W G Q P H G G G G W G Q G G S H S cagtggaacaagcccagtaagccaaaaaccaacatgaagcatgtggcaggagctgctgca Q W N K P S K P K T N M K H V A G A A A gctggagcagtggtagggggccttggtggctacatgctgggaagtgccatgagtaggcct A G A V V G G L G G Y M L G S A M S R P cttatacattttggcaatgactatgaggaccgttactatcgtgaaaacatgtaccgttac L I H F G N D Y E D R Y Y R E N M Y R Y cccaaccaagtgtactacagaccagtggatcagtatagtaaccagaacaactttgtgcat P N Q V Y Y R P V D Q Y S N Q N N F V H gactgtgtcaacatcacagtcaagcaacacacagtcaccaccaccaccaagggggagaac D C V N I T V K Q H T V T T T T K G E N ttcaccgaaactgacatcaagataatggagcgagtggtggagcaaatgtgcatcacccag F T E T D I K I M E R V V E Q M C I T Q taccagagagaatcccaggcttattaccaaaggggggcaagtgtgatcctcttttctccc Y Q R E S Q A Y Y Q R G A S V I L F S P cctcctgtgatcctcctcatctctttcctcatttttctcatagtaggatag P P V I L L I S F L I F L I V G -
Reference sequences:
>wildtype pro Capra hircus [Note: do not use either GenBank sequence as replacement]
MVKSHIGSWILVLFVAMWSDVGLCKKRPKPGGGWNTGGSRYPGQGSPGGNRYPPQGGGGWGQphgggwgqphgggwgqPHGGGWGQPHGGGGWGQGGSHSQw
NKPSKPKTNMKHVAGAAAAGAVVGGLGGYMLGSAMSRPLihFGNDYEDRYYRENMYRYPNQVYYRPVDQYSNQNNFVHDCVNITVKQHTVTTTTKGENFTET
DIKIMERVVEQMCITQYQRESQAYYQRGASVILFSpPPVILLISFLIFLIVG
>allpoly pro Capra hircus [Composite of all known goat polymorphisms]
MVKSHIGSWILVLFVAMWSDVGLCKKRPKPGGGWNTGGSRYPGQGSPGGNRYPPQGGGGWGQPHGGGWGQPHGGGGWGQGGSHSQgN
KPSKPKTNMKHVAGAAAAGAVVGGLGGYMLGSAMSRPLmrFGNDYEDRYYRENMYRYPNQVYYRPVDQYSNQNNFVHDCVNITVKQHT
VTTTTKGENFTETDIKIMERVVEQMCITQYQRESQAYYQRGASVILFSsPPVILLISFLIFLIVG
>wildtype dna Capra hircus [Note: do not use either GenBank sequence as replacement]
atggtgaaaagccacataggcagttggatcctggttctctttgtggccatgtggagtgacgtgggcctctgcaagaagcgaccaaaacctggcggaggatggaacactggggggagccgatacccgggacaggg
cagtcctggaggcaaccgctatccacctcagggagggggtggctggggtcagccccatggaggtggctggggccaacctcatggaggtggctggggtcagccccatggtggtggctggggacagccacatggtg
gtggaggctggggtcaaggtggtagccacagtcagtggaacaagcccagtaagccaaaaaccaacatgaagcatgtggcaggagctgctgcagctggagcagtggtagggggccttggtggctacatgctggga
agtgccatgagcaggcctcttatacattttggcaatgactatgaggaccgttactatcgtgaaaacatgtaccgttacccaaccaagtgtactacagaccagtggatcagtatagtaaccagaacaactttgtgcat
gactgtgtcaacatcacagtcaagcaacacacagtcaccaccaccaccaagggggagaacttcaccgaaactgacatcaagataatggagcgagtggtggagcaaatgtgcatcacccagtaccagagagaat
cccaggcttattaccaaaggggggcaagtgtgatcctcttttctccccctcctgtgatcctcctcatctctttcctcatttttctcatagtaggatag
>allpoly dna Capra hircus [Composite of all known goat polymorphisms]
atggtgaaaagccacataggcagttggatcctggttctctttgtggccatgtggagtgacgtgggcctctgcaagaagcgaccaaaacctggcggaggatggaacactggggggagccga
tacccaggacagggcagtcctggaggcaaccgctatccacctcagggagggggtggctgggtcagccccatggaggtggctggggccaacctcatggaggtggctggggtcagccccat
ggtggtggctggggacagccacatggtggtggaggctggggtcaaggtggtagccacagtcaggggaacaagcccagtaagccaaaaaccaacatgaagcatgtggcaggagctgctgca
gctggagcagtggtagggggccttggtggctacatgctgggaagtgccatgagtaggcccttatgcgttttggcaatgactatgaggaccgttactatcgtgaaaacatgtaccgtta
cccaaccaagtgtactacagaccagtggatcagtatagtaaccagaacaactttgtgcatgactgtgtcaacatcacagtcaagcaacacacagtcaccaccaccaccaagggggagaac
ttcaccgaaactgacatcaagataatggagcgagtggtggagcaaatgtgcatcacccagtaccagagagaatcccaggcttattaccaaaggggggcaagtgtgatcctcttttcttcc
cctcctgtgatcctcctcatctctttcctcatttttctcatagtaggatag
J Gen Virol 1996 Nov;77 ( Pt 11):2885-91 Published erratum appears in J Gen Virol 1997 Mar;78(Pt 3):697 [Affects labels to one of the figures, amount of gene sequenced, survival times] Goldmann W, Martin T, Foster J, Hughes S, Smith G, Hughes K, Dawson M, Hunter NAge at disease onset and rate of progression of transmissible spongiform encephalopathies in man, sheep and mice are modulated by the host genome, in particular by the PrP gene and its allelic forms. Analysis of the caprine PrP gene revealed several different alleles. Four PrP protein variants were found, three of which were goat specific with single amino acid changes at codons 142, 143 and 240. The fourth was identical to the most common sheep PrP protein variant (Ala136-Arg154-Gln171). The dimorphism at codon 142 (Ile --> Met) appeared to be associated with differing disease incubation periods in goats experimentally infected with isolates of bovine spongiform encephalopathy, sheep scrapie CH1641 or sheep-passaged ME7 scrapie.
Cell Mol Neurobiol 1998 Dec;18(6):731-42 Katamine S, Nishida N, Sugimoto T, Noda T, Sakaguchi S, Shigematsu K,Kataoka Y, Nakatani A, Hasegawa S, Moriuchi R, Miyamoto TPrion protein (PrPC) is a host-encoded glycoprotein constitutively expressed on the neuronal cell surface. Accumulation of its protease-resistant isoform is closely related to pathologic changes and prion propagation in the brain tissue of a series of prion diseases. However, the physiological role of PrPC remains to be elucidated.
After long-term observation, we noted impaired motor coordination and loss of cerebellar Purkinje cells in the aged mice homozygous for a disrupted PrP gene, a finding which strongly suggests that PrPC plays a role in the long-term survival of Purkinje cells. We also describe the resistance of the PrP null mice to the prion, indicating the requirement of PrPC for both the development of prion diseases and the prion propagation.
J Neurol Neurosurg Psychiatry 1999 Jan;66(1):90-2 Arnold SE, Trojanowski JQ, Parchi PVarious clinical and epidemiological data have suggested the possibility of infectious mechanisms in schizophrenia. In addition, lengthy prodromal psychiatric symptoms can presage the development of Creutzfeldt-Jakob disease, a prototypical prion disorder. Accordingly, the presence of human protease resistant prion proteins (PrPres) was assessed in postmortem frontal cortical and thalamic tissues from a prospectively accrued and well characterised sample of elderly patients with chronic, sporadic, "poor outcome" schizophrenia using a sensitive immunoblot assay. No PrP-res was found in the brains of any of the cases, providing evidence against a role for abnormal prion proteins in the pathogenesis of schizophrenia.
8 Jan 99 webmasterThere is a way of searching full text of dozens of journals; right now, it is one journal at a time but this month it should go to many at once. (The site also provides buttons for current issue and future contents. This is a very signficant addition to what can be done with Medline. However, if a word like 'prion' is used only in the body of the text, that use may well be tangential to the main thrust of the article. No context is provided.
A quick one-by-one search for articles published in 1998 lacking 'prion' in the title or abstract but having 'prion' in the full-text [ie, supplemented Medline] turns up the articles below. Most journals still block access to single articles unless a full year subscription is ordered; better journals provide instant access for $4-$5.
J. Cell Biol. 1998 140: 525-540. Laurence Abrami, Marc Fivaz, Pierre-Etienne Glauser, Robert G. Parton, and F. van der Goot
Patrick Keller and Kai Simons J. Cell Biol. 1998 140: 1357-1367.
Richard M. Siegel, David A. Martin, Lixin Zheng, Samuel Y. Ng, John Bertin, Jeffrey Cohen, and Michael J. Lenardo J. Cell Biol. 1998 141: 1243-1253.
Christian Kutzleb, Gabriele Sanders, Raina Yamamoto, Xiaolu Wang, Beate Lichte, Elisabeth Petrasch-Parwez, and Manfred W. Kilimann J. Cell Biol. 1998 143: 795-813.
Thomas M. Stulnig, Markus Berger, Thomas Sigmund, Daniel Raederstorff, Hannes Stockinger, and Werner Waldh”usl J. Cell Biol. 1998 143: 637-644.
Sangram S. Sisodia Cell 1998 95: 1-4. [Full Text]
Elisabeth AndrÈ, FranÁois Conquet, Markus Steinmayr, Sharon C. Stratton, Vittorio Porciatti, and Michael Becker-AndrÈ EMBO J. 1998 17: 3867-3877.
Michael C. Lorenz and Joseph Heitman EMBO J. 1998 17: 1236-1247.
Franck Duong and William Wickner EMBO J. 1998 17: 696-705.
Christopher M. Dobson and R.John Ellis EMBO J. 1998 17: 5251-5254.
The EMBO Journal Vol. 17,pp. 4626-4638, 1998 Satyajit Mayor, Shefali Sabharanjak and Frederick R. MaxfieldSeveral cell surface eukaryotic proteins have a glycosylphosphatidylinositol (GPI) modification at the C terminal end that serves as their sole means of membrane anchoring. Using fluorescently labeled ligands and digital fluorescence microscopy, we show that contrary to the potocytosis model, GPI-anchored proteins are internalized into endosomes that contain markers for both receptor-mediated uptake (e.g. transferrin) and fluid phase endocytosis (e.g. dextrans).
This was confirmed by immunogold electron microscopy and the observation that a fluorescent folate derivative bound to the GPI-anchored folate receptor is internalized into the same compartment as co-internalized horseradish peroxidase-transferrin; the folate fluorescence was quenched when cells subsequently were incubated with diaminobenzidine and H2O2. Most of the GPI-anchored proteins are recycled back to the plasma membrane but at a rate that is at least 3-fold slower than C6-NBD-sphingomyelin or recycling receptors.
This endocytic retention is regulated by the level of cholesterol in cell membranes; GPI-anchored proteins are recycled back to the cell surface at the same rate as recycling transferrin receptors and C6-NBD-sphingomyelin in cholesterol-depleted cells. Cholesterol-dependent endocytic sorting of GPI-anchored proteins is consistent with the involvement of specialized lipid domains or `rafts' in endocytic sorting. These results provide an alternative explanation for GPI-requiring functions of some GPI-anchored proteins.
Genetics, Vol. 149, 1763-1775, August 1998 BÈnÈdicte Gagnya and Philippe SilaraIn an attempt to decipher their role in the life history and senescence process of the filamentous fungus Podospora anserina, we have cloned the su1 and su2 genes, previously identified as implicated in cytosolic translation fidelity. We show that these genes are the equivalents of the SUP35 and SUP45 genes of Saccharomyces cerevisiae, which encode the cytosolic translation termination factors eRF3 and eRF1, respectively.
Mutations in these genes that suppress nonsense mutations may lead to drastic mycelium morphology changes and sexual impairment but have little effect on life span. Deletion of su1, coding for the P. anserina eRF3, is lethal. Diminution of its expression leads to a nonsense suppressor phenotype whereas its overexpression leads to an antisuppressor phenotype. P. anserina eRF3 presents an N-terminal region structurally related to the yeast eRF3 one. Deletion of the N-terminal region of P. anserina eRF3 does not cause any vegetative alteration; especially life span is not changed. However, it promotes a reproductive impairment.
Contrary to what happens in S. cerevisiae, deletion of the N terminus of the protein promotes a nonsense suppressor phenotype. Genetic analysis suggests that this domain of eRF3 acts in P. anserina as a cis-activator of the C-terminal portion and is required for proper reproduction
Genome Res. 8: 871-880. Christian Lavedan1The synuclein gene family recently came into the spotlight, when one of its members, alpha-synuclein, was found to be mutated in several families with autosomal dominant Parkinson's disease (PD). A peptide of the -synuclein protein had been characterized previously as a major component of amyloid plaques in brains of patients with Alzheimer's disease (AD). The mechanism by which this presynaptic protein is involved in the two most common neurodegenerative disorders, AD and PD, remains unclear. Remarkably, another member of this gene family, -synuclein, has been shown to be overexpressed in breast carcinomas and may also be overexpressed in ovarian cancer. The possible involvement of the synuclein proteins in the etiology of common human diseases has raised exciting questions and is the subject of intense investigation. Details of the properties of any member of the synuclein family may provide useful information for understanding the characteristics and function of other family members. The present review offers a synopsis of the current state of knowledge of all synuclein family members in different species.
Bogos Agianian, Kevin Leonard, Edgar Bonte, Hans Van der Zandt, Peter B. Becker, Paul A. Tucker JMB 1998 p527-544
Claire Goldsbury, Joerg Kistler, Ueli Aebi, Tudor Arvinte, Garth J. S.Cooper JMB 1998.2299p33-39
Duncan R. Hewett, Oliva Handt, ...and Robert Richards Molec Cell 1998 1: 773-781.
Annie Sittler, Stephanie W”lter, ... and Erich E. Wanker Molec Cell 1998 2: 427-436.
Dec. 12-16, 1998, San Francisco, CAThe Am Soc Cell Biology meeting site is exceedingly poorly organized, the little available is in gigantic unsearchable pdf. There is no provision of abstracts, no searching. In 1999 they will require electronic submission of abstracts. Duh. I could not do more than search their clumsy author index, then collect session themes that contained the codes. I guess you had to be there. -- webmaster]
B123-B139 Protein Folding and Assembly B140-B153 Protein Targeting to the Cell Surface C29-C42 Host-Parasite Interactions II Prusiner, S,B, 450 12/13/1998 Poster 12:00 B-145 Prusiner, S,B, 2639 12/16/1998 Poster 1:30 B-138 Prusiner, S,B, 2907 12/16/1998 Poster 12:00 C-37 Lindquist, S,L, 3 12/12/1998 Keynote Sympo 7:00 - Lindquist, S,L, 2511 12/16/1998 Poster 1:30 B-10 Lindquist, S,L, 2638 12/16/1998 Poster 12:00 B-137A New Mechanism of Inheritance Based Upon the Transmission of Proteins with Altered, Self-Perpetuating Conformations...Susan Lindquist, University of Chicago -=-=-=-=-==
The group's new web page on BSE/CJD research: Dr Christl A Donnelly Wellcome Trust Centre for the Epidemiology of Infectious Disease Department of Zoology University of Oxford
The Lancet 352: 1353-1354, 1998. Ghani AC, Ferguson NM, Donnelly CA, Hagenaars TJ and Anderson RM.The authors comment on one of their web pages,
"If the diagnostic test is able to detect abnormal prion protein for the last 75% of the incubation period, our model predicts that the current detectable prevalence of infection lies anywhere between 0.7 and120,000 infections per million people (Ghani et al. 1998b). Large sample sizes are required to estimate this prevalence. For example, if 40,000 tissue samples were screened, and one was infected, the 95% confidence interval for the prevalence of infection in 1998 would be 0.6-140 infections per million people, consistent with epidemic sizes up to 15,000 cases.
Hence, if large numbers of tissues are screened, and a small number of infections detected, very large epidemics could be ruled out. If a large number of infections were detected, then the specificity of the test needs to be addressed ‚ i.e. we must ask the question åWill an infected person develop clinical disease?¼. However, if the test is only able to detect infection later in the incubation period (for example, in the last 50% of the incubation period), then the uncertainty in the future size of any epidemic is likely to remain.
Our work to date has assumed that the tissue samples will be taken from a random sample of the general population. However, if tonsil tissues are used, the sample is likely to contain more tissue taken from younger people. In future work we will relate detectable age-specific prevalence to future epidemic size to guide the design of unlinked anonymous screening programmes. In this way we can make the best use of screening resources and, in particular, determine whether a sufficient number of informative samples are available. "
Proceedings of the Royal Society London B 265,2443-2452, 1998. Ghani AC, Ferguson NM, Donnelly CA, Hagenaars TJ and Anderson RM.
5 Jan 99 Antwerp home page
Dear Colleague We are now offering 14-3-3 detection in the cerebrospinal fluid for the differential diagnosis of Creutzfeldt-Jakob's disease. The test will be performed on a research basis, in exchange for the CSF and adequate clinical data, without cost to the hospital or patient. The results of this test have to be interpreted in the context of other clinical and laboratory data. Enclosed, you will find a summary of our protocol and quality assurance program. Should you have any questions concerning this test, please feel free to contact us Prof. Dr. Patrick Cras Tel : 03 821 34 23
Patrick Cras, Bart Van Everbroeck, Philippe Pals and Jean-Jacques MartinBelgium CJD age distribution:
'Of 96 patients of whom the sex was known, there were 65 women and 31 men. The female preponderance has been widely described. [???] Our youngest patient was 30 at death [another was 32], the oldest 83. Of the total population of 100 patients, 96 suffered from the sporadic type of CJD, while 4 suffered from a hereditary form. In two patients of the same family, the genetic abnormality was identified as an insertion in the prion protein gene. In our series, we could find no evidence for the new variant, nor for an iatrogenic cause.'
J Biol Chem, Vol. 274, Issue 3, 1181-1184, January 15, 1999 Susan W. Liebman and Irina L. Derkatch.. After a historical review, the authors note that, "The finding that the chaperone protein Hsp104 is required for the propagation of Psi+ provided dramatic support for the prion model, because the only known function of Hsp104 is to facilitate the folding of proteins. An excess of Sup35 protein and not an excess of SUP35 DNA or mRNA established that Sup35p is not only necessary, but is also sufficient, to cause Psi+.
There is now direct evidence that Sup35p exists in different structural states in Psi+ and [psi] cells. Sup35p in lysates of Psi+ but not [psi] strains showed increased protease resistance and aggregation, two characteristics typical of mammalian prions. Psi+ aggregates were detected by sedimentation and were visualized in vivo using fusions of Sup35p with green fluorescent protein. Also, Sup35p isolated from Psi+ but not [psi] strains could bind the N-terminal fragment of Sup35p.
Sup35pPSI+ can efficiently stimulate the aggregation of soluble Sup35p psi from [psi] lysates. Because the only cellular fraction that promotes this in vitro conversion is that containing the Sup35pPSI+ aggregates, it appears that soluble Sup35pPSI+ molecules either do not exist or are unable to initiate the conversion. This finding supports the seeded polymerization model that predicts that conversion to the prion conformation occurs upon aggregation.
Finally, purified Sup35p has been shown to form ordered fibers in vitro, and the rate of fiber formation is stimulated by the addition of small amounts of preformed fiber (26, 27). Sup35p fibers are similar to amyloid fibers associated with certain human diseases because they bind Congo red [this is of far less interest than CR birefringence -- webmaster] and are rich in -sheet structure. Although such fibers have not yet been found in vivo, these results suggest that Sup35pPSI+ is an amyloid-like fiber and that the in vitro change in conformation represents the mechanism for propagation of Psi+. These results can be interpreted in terms of the seeded nucleation model; however, the initial rate of unseeded fiber nucleation is not as dependent upon the concentration of soluble Sup35p monomers as predicted by the original polymerization model.

Sup35p can be roughly divided into three domains: N, M, and C. The C domain is essential, apparently because of its function in translation termination (see below). The N region and the highly charged M region are not essential, but, as mentioned above, strains lacking the N or NM regions cannot maintain Psi+ (21) [i.e.,they still do not know normal function of the crucial N terminal domain -- webmaster].
The inability to maintain Psi+ (Pnm phenotype) in such deletion-bearing mutants is recessive. Furthermore, the overexpression of just the N-terminal fragments of Sup35p (as small as 113Ýamino acids) is sufficient to induce the de novo appearance of Psi+ visualized as Psi+-specific aggregates with the green fluorescent protein fusion constructs and/or detected genetically. These data suggest that the Psi+ prion domain in Sup35p is limited to the N part of the protein. Moreover, most of the in vitro experiments described above as proof of the prion model for Psi+/Sup35p were successfully reproduced using the Sup35p N part alone.
The N region of Sup35p contains two structurally unusual regions involved in Psi+ biogenesis. All sup35 point mutations that inhibit Psi+ propagation (PNM) or reduce Psi+-associated suppression (ASU, antisuppression) are located within or very close to these regions. The first region (amino acids 8-26) is rich in glutamine and asparagine. Changes there lead to both Pnm and Asu phenotypes (28). Generally, the presence of plasmids bearing PNM mutant alleles led to a reduction in aggregation of both the mutant and wild-type Sup35 proteins, whereas ASU plasmids reduced the aggregation of just the mutant protein.
The second region (amino acids 56-97) consists of four and a half nanopeptide repeats that are structurally similar to the octapeptide repeats found in the mammalian PrP prion. A G58D substitution in the repeat region was originally described as a dominant PNM mutation (17). It now appears that this mutation, called PNM2, only causes Psi+ loss in some genetic backgrounds and can cause the de novo induction of Psi+ when overexpressed .1 Even in backgrounds where PNM2 does not cure Psi+ it affects the Psi+ phenotype in an unusual manner (see below).
Although differences between Psi+ and [psi] strains have been known for some time, it has only recently become clear that not all Psi+ strains contain the same Psi+ factors (23). Indeed, Psi+ derivatives with different characteristics, called weak and strong Psi+ variants, can be obtained in the same strain when the same SUP35 gene is overproduced (Fig. 1). Weak Psi+ derivatives suppress nonsense mutations poorly and are lost in 1-3% of mitotic progeny. Strong Psi+ variants cause higher levels of suppression and are very stable. These phenotypic differences appear to be associated with the Psi+ elements and are not the result of nuclear mutations. Although Sup35p is aggregated in both weak and strong Psi+ derivatives, the level and speed of aggregation are greater in strong Psi+ derivatives.2 Strong Psi+ is dominant over weak Psi+,1 but it remains unclear if Sup35pweakPSI+ is lost in the presence of Sup35pstrongPSI+ or if the different Psi+ forms co-exist.
The different Psi+ elements are analogous to the mysterious scrapie "strains"... The finding in yeast of different Psi+ variants arising from overexpression of Sup35p is incompatible with the viral hypothesis and by analogy with the mammalian results suggests that there is more than one type of Sup35pPSI+ conformation or more than one type of Psi+ aggregate. Indeed, the Sup35p fibers formed in vitro have been shown to exist in distinct structural forms, "wavy" or "straight," and transitions between these forms are not observed within the same fiber, indicating that they may represent a structural basis for Psi+ variants.
An intermediate level of the chaperone Hsp104 has been shown to be required for the maintenance of Psi+. Deletion of HSP104 cured Psi+, whereas overexpression of HSP104 reduced the Psi+ phenotype or, at a higher dose, caused the permanent loss of the Psi+. Similarly, cells cured of Psi+ by deletion or overexpression of HSP104 lack Psi+ aggregates, and even under conditions when Psi+ is not cured, overexpression of Hsp104 causes partial release of Sup35p from the pellet fraction.
The ability of overexpressed Hsp104 to cure Psi+ or inhibit its phenotype has recently been shown to be interfered with by the simultaneous overexpression of SSA1, a member of the Hsp70 family. This may explain why conditions that normally induce Hsp104 together with Hsp70, such as heat shock, stationary phase growth, and sporulation, do not efficiently cure Psi+ (60).
...
Although overexpression of Sup45p inhibits the de novo induction of Psi+ by excess Sup35p, it has no effect on the propagation of Psi+ (38). The excess Sup45p may bind to Sup35ppsi, thereby inhibiting a de novo conformational change to Sup35pPSI+, but may fail to compete with established Sup35pPSI+ aggregates for the binding of Sup35ppsi. Simultaneous overexpression of Sup45p and Sup35p causes antisuppression and does not cause growth inhibition even in the presence of strong Psi+, whereas overexpression of Sup45p alone causes allosuppression of weak Psi+, and overexpression of Sup35p alone severely inhibits growth of strong Psi+ derivatives (38, 45, 46). Possibly the unbalanced excess of one of the release factors allows it to deplete the termination complex of an essential protein.
SAL-- Mutations in the SAL genes were isolated as allosuppressors, which enhanced the efficiency of suppressors, and were shown to be at unlinked loci (2). Surprisingly, certain recessive sal6 alleles failed to complement recessive allosuppressor mutations in the SAL1, SAL2 (allelic to UPF1),5 SUP35, SUP45, and SAL5 loci (47). This unusual complementation pattern and the fact that sal6 and sup45 mutants had a synergistic interaction leading to a cold-sensitive phenotype suggested that the proteins encoded by all these genes interact. Indeed, we now know that Sup35p, Sup45p, and Upf1p do interact in a complex (see below), and it is possible that Sal6p, a PP1-serine threonine phosphatase with a long Ser-Asp-rich N-terminal extension , is also part of or may modify proteins in this complex. SAL1 and SAL5 remain to be cloned.
UPF-- Purified eRF1 and eRF3 bind to purified Upf1p, a member of the group I family of helicases (49). Upf2p and Upf3p also appear to complex with Upf1p (50). It was proposed that these proteins form a "surveillance complex" that functions first in translational termination, and then, after the dissociation of the RF factors, in the decay of mRNA containing premature nonsense codons (49). Upf1p is not required for the maintenance of Psi+ but was found associated with Psi+ aggregates (49). It is thus possible that strong Psi+ elements may stabilize mRNA with premature stops by removing Upf1p from the "surveillance complex" into the Psi+ aggregate. Although a strong Psi+ strain has not yet been examined, no difference in mRNA stability was observed when an isogenic weak Psi+ and [psi] strain were compared.5
ASU-- Antisuppressor mutations in ASU9 reduce the efficiency of sup45 and sup35 suppressors but have no effect on other suppressors, whereas mutations in ASU10 act only on sup35 (51, 52). Furthermore, the fact that the asu9-1 mutation reduces the paromomycin sensitivity of sup45-2 even though it causes sensitivity to paromomycin in the absence of sup45-2 suggests a physical interaction between Asu9p and Sup45p. Ý ÝÝ
Sup35p may have functions distinct from its role in the termination of translation. The potential role of Sup35p and Psi+ in nonsense-mediated mRNA decay was discussed above. It has also been suggested that Sup35p may be involved in the control of the cell cycle (56) and processes involving microtubules (57). Finally, deletion of the Sup35p N-terminal region in P.Ýanserina alters the sexual cycle of this organism (54).
Forthcoming J Gen Virol Jan 1999 v80 no abstracts available yet.J Gen Virol says, "We will be providing Internet access early in 1999 to the full text, headers and tables of contents for all the articles in our journals. The text will be searchable and among numerous extra features will be inter-article (cross-journal) linking and links to the PubMed and MedLine databases. The journals are being made available in association with HighWire Press, Stanford. This service will initially be freely accessible by the public; later in 1999 access will be restricted to institutions with a subscription to the print version. There will be no extra charge to these subscribers. "
J. Hope, S. C. E. R. Wood, C. R. Birkett, A. Chong, M. E. Bruce, D. Cairns, W. Goldmann, N.Hunter and C. J. Bostock 80:1 - 4Comment(webmaster): Similarities between BSE and an experimental isolate of natural scrapie, CH1641. suggests the long-sought missing scrapie strain that could have given rise to the BSE epidemic. It would raise additional questions about the harmlessness to humans of scrapie.
On the other hand, CH1641 happened to be one of the scrapie strains studied very recently by Collinge's group, Neurosci Lett. 1998 Oct 23;255(3):159-62. It did not have the prp-sc type identical to BSE passaged in sheep.
The CH1641 strain is mentioned only twice before in Medline abstracts (though there could be many fulltext mentions), one of these being the original naming of the strain in 1988.
Comment(Alex Bossers):
Considering the supposed similarities of BSE and CH1641.
In my opinion CH1641 is only an isolate of ARQ (genotype) scrapie, not a strain. Homology of ARQ with i.e. bovine-PrP results in a more easy transmission of BSE to ARQ-sheep and probably visa versa. (see discussion of our PNAS 1997 94:4931-4936 paper, parts attached). So a non matching glycoprofile of CH1641 and BSE is no surprise to me. We've for instance never seen glycoprofiles of natural scrapie cases (different genotypes) matching the BSE profile.
Abbreviations: VQ=VRQ, AQ=ARQ, AR=ARR
Not only the primary PrPC sequence was found to determine the conversion characteristics but also the primary amino acid sequence of PrPSc. PrPSc(VQ/VQ) converted PrPC_VQ, PrPC_AQ, and PrPC_AR with decreasing efficiencies. In contrast, PrPSc(AQ/AQ) converted PrPC_VQ almost as efficiently as the PrPC_AQ variant. The PrPC_AR variant was poorly converted by both PrPSc isolates.
This suggests that scrapie susceptibility is not only determined by the PrP genotype of the acceptor animal but also by the PrP genotype of the animal that produced the infectious PrPSc. This is consistent with the finding that the SSBP/1 scrapie isolate obtained from PrPVQ NPU-Cheviot sheep is best transmitted to PrPVQ sheep (12, 17). It is also consistent with the striking behaviour of the CH1641 scrapie isolate, which was primarily isolated from a 'positive line' (mainly PrPVQ carrying) NPU Cheviot sheep, when passaged in 'positive-line' or 'negative-line' (non-PrPVQ) Cheviot sheep.
The first (primary) intracerebral passage of this 'positive-line' material to 'positive-line' Cheviot sheep resulted in short incubation times. Passage of the primary CH1641 isolate into 'negative-line' Cheviot sheep resulted in longer incubation times (33) probably due to polymorphism barriers. If the 'negative-line' passaged isolates were subsequently passaged in 'negative-line' Cheviot sheep the incubation times in this line of sheep decreased (17, 33). A subsequent passage from these 'negative-line' to 'positive-line' Cheviot sheep increased the incubation times dramatically (17, 33) again probably due to the 'polymorphism barrier'....
Interestingly, a homogenate of BSE, of which the primary amino acid sequence (at the polymorphic amino acid positions of sheep PrP) is best comparable with the sheep PrPAQ genotype, gives the shortest incubation times in PrPAQ sheep if inoculated by the intracerebral route. If inoculated via the longer oral route however, PrPVQ sheep have the shortest incubation time (17). Probably inoculation via the oral route, compared to inoculation by the intracerebral route, extends the incubation time long enough to overcome the polymorphism barrier and subsequently allows the agent to spread more quickly using PrPC_VQ instead of PrPC_ AQ.
Comment(webmaster):
So what exactly will be in their forthcoming paper, given the results in the PNAS and Collinge papers.
Is there such a thing as an 'official' list of scrapie strains? How can there be strain-typing without type specimens? I was shocked to read in the Collinge paper that no one had ever systematically archivee material in all these decades. Who knows what genotype they were or what genotypes they were being passaged in? I am especially interested in the scrapie strain amplified during the louping ill vaccine incident in the 1930's because that one may have been the first exported to North America and the basis for subsequent problems.
Foster JD, Dickinson AG Vet Rec 1988 Jul 2;123(1):5-8An isolate of scrapie designated CH1641 was identified from a natural case of scrapie in a Cheviot sheep by passage in sheep and goats. It has not been possible to transmit scrapie to mice from this source. The Sip gene which controls the incubation periods of experimental scrapie in Cheviot sheep has two alleles; sA which shortens and pA which lengthens the incubation periods of most strains of scrapie after the first experimental injection in sheep (the A group of strains). The CH1641 isolate differs from them in that the alleles of Sip act in the opposite way, with incubation being shorter in the pA homozygotes. There is some evidence that one or more genes, in addition to Sip, may be implicated in the control of scrapie incubation in sheep and the possibility of a carrier infection with CH1641 is also discussed.
R. I. Carp, H. C. Meeker, V. Caruso and E. Sersen 80:5 - 10
A. F. Hill, M. Antoniou and J. Collinge 80:11 - 14
O. Windl, H. Lorenz, C. Behrens, A. R–mer and H. A. Kretzschmar 80:15 - 21
Alves-Rodrigues A, Gregori L, Figueiredo-Pereira ME Trends Neurosci 1998 Dec;21(12):516-20Covalent binding of ubiquitin to proteins marks them for degradation by the ubiquitin/ATP-dependent pathway. This pathway plays a major role in the breakdown of abnormal proteins that result from oxidative stress, neurotoxicity and mutations. Failure to eliminate ubiquitinated proteins disrupts cellular homeostasis, causing degeneration. Inclusions containing ubiquitinated proteins are commonly detected in many neurological disorders. These aggregates are mostly cytosolic; nevertheless, ubiquitinated inclusions are found in endosomes/lysosomes in Alzheimer's disease and prion encephalopathies, and in nuclei in disorders associated with CAG/polyglutamine repeats, such as Huntington's disease and spinocerebellar ataxias. Ubiquitinated aggregates must result from a malfunction or overload of the ubiquitin/ATP-dependent pathway or from structural changes in the protein substrates, halting their degradation. Prevention of protein aggregation in these diseases might offer new therapeutic leads.