Double mutants: is disease onset shorter or the same?
London to get CJD research centre
PPND and FTDP as tau repeat diseases.
Inhibiting transthyretin conformational changes
100,000 bp of human, mouse, sheep, prion genes
White-tailed deer alleles
Mystery prion peptides and alternative regulation
Phenotype-genotype studies in kuru
Phenotypic variability of GSS: new mutations D202N, GSS Q212P
Two reviews of genetic neurodegenerative diseases
PNAS Vol. 95, Issue 22, 13103-13107, October 27, 1998 Clark, LN et al.Pallido-ponto-nigral degeneration (PPND) is one of the most well characterized familial neurodegenerative disorders linked to chromosome 17q21-22. These hereditary disorders are known collectively as frontotemporal dementia (FTD) and parkinsonism linked to chromosome 17 (FTDP-17). Although the clinical features and associated regional variations in the neuronal loss observed in different FTDP-17 kindreds are diverse, the diagnostic lesions of FTDP-17 brains are tau-rich filaments in the cytoplasm of specific subpopulations of neurons and glial cells.
The microtubule associated protein (tau) gene is located on chromosome 17q21-22. Two missense mutations in exon 10 of the tau gene that segregate with disease, Asn279Lys in the PPND kindred and Pro301Leu in four other FTDP-17 kindreds, were found. A third mutation was found in the intron adjacent to the 3' splice site of exon 10 in patients from another FTDP-17 family. [ All of these mutations are in or near coding sequence for the C-terminal tandem imperfect repeats that contain microtubule (MT)-binding sites. Differential splicing of transcripts normally leads to production of tau isoforms with three or four MT-binding sites. ]
Transcripts that contain exon 10 encode tau isoforms with four microtubule (MT)-binding repeats (4Rtau) as opposed to tau isoforms with three MT-binding repeats (3Rtau). The insoluble tau aggregates isolated from brains of patients with each mutation were analyzed by immunoblotting using tau-specific antibodies. For each of three mutations, abnormal tau with an apparent Mr of 64 and 69 was observed. The dephosphorylated material co-migrated with tau isoforms containing exon 10 having four MT-binding repeats but not with 3Rtau. Thus, the brains of patients with both the missense mutations and the splice junction mutation contain aggregates of insoluble 4Rtau in filamentous inclusions, which may lead to neurodegeneration.

The following evidence argues that the Asn279Lys and Pro301Leu variants described here and the Val337Met variant (7) are pathogenic mutations: (i) The mutations segregate with the disease in each family studied; (ii) the mutations are observed only in FTDP-17 kindreds (one family each for the Asn279Lys and the Val337Met mutations and in four families for the Pro301Leu mutation) and not in 95 controls; and (iii) the Pro301Leu change is in a functional domain (MT-binding repeat) and is conserved in all MT-binding repeats of humans and other species. The Val337Met mutation is also at a site in the inter-repeat sequences between the MT-binding repeats that is conserved in all three inter-repeats in human and mouse tau (7). Similarly, the Asn279Lys mutation is at an inter-repeat site conserved between human and mouse.
The evidence that an intronic nucleotide substitution 3' to exon 10 is pathogenic is: (i) The mutation is found only in subjects affected with DDPAC and not in controls; and (ii) even though disease in this family clearly segregates with 17q21-22 markers, no other mutation was found in any coding exon. The location of this mutation is adjacent to the splice donor sequence for exon 10 (Fig. 2A), and thus it is difficult from the sequence alone to predict the functional consequences of the mutation. We propose that the mutation may affect the splicing to cause an increased production of 4Rtau.
Tau proteins in the human brain consist of six alternatively spliced isoforms with three or four imperfect tandem MT-binding repeats in the carboxy-terminal domain as well as one, two, or no amino-terminal inserts. Although the function of the amino-terminal inserts is unknown, the function of the carboxy-terminal MT-binding repeats is to bind and stabilize MTs. Thus, mutations in the MT binding repeats could reduce the binding of tau to MTs, resulting in the accumulation of excess tau as insoluble filamentous aggregates in the perikarya of neurons.
Another hypothesis is that these mutations enhance the tau-tau interactions that occur when abnormal filaments are formed. Thus, the mutations would accelerate the formation of these filaments, which in turn could be toxic to specific cells.
Finally, the identification of an intronic mutation adjacent to the splice donor consensus sequence of exon 10 in the tau gene suggests a possible defect in the regulation of exon 10 splicing. Because this C to T intronic mutation resides within the "stem" of a short potential stem-loop structure (12-base stem, 6-base loop) that spanned the splice site of exon 10, it could lead to destabilization of the stem-loop structure, resulting in increased production of mRNA with exon 10. This in turn will lead to an increased production of 4Rtau. Two other papers have identified additional mutations in the 3' prime region of exon 10 that are posited to affect RNA splicing.
Another protein in the same issue of PNAS is also somewhat analagous to prion protein in the evolution and composition its repeats:
PNAS Vol. 95, Issue 22, 13056-13061, October 27, 1998 our times higher than the lowest one, with a mean of 4.7 X 10(-9) substitutions per synonymous site per year. Although the overall evolutionary rate for amelogenin is slow, some regions of the polypeptide appear to evolve rapidly and undergo insertions or deletions of codons readily. This is apparent in the proline/glutamine repeat region (residues 120-200) of exon 6. The cattle X linked, as well as the opossum and caiman sequences, are up to 28 aa longer in this region than other sequences. Because the repeat region lies within an exon, these indels are not a result of alternative splicing.
The variability of the repeat region even between closely related genes suggests that there is a strong propensity for indels to occur frequently, perhaps by replication slippage between the repeat motifs. The C-terminal portion of the core region contains multiple tripeptide repeat sequences (Pro-X-Gln)n that are apparently responsible for the variability observed among the different proteins.
In eutherian mammals, the average nonsynonymous evolutionary rate of the amelogenin genes (0.5 x109 per nonsynonymous site per year) is less than the average found for 40 genes (0.9 x 10(9) per site per year) by Li et al. (32). The rate of nonsynonymous substitution is extremely variable among genes; it ranges from 0.004 X 10(-9) (histone H4) to 2.80 X 10(-9) (interferon gamma), with a mean of 0.88 X 10(-9) substitutions per nonsynonymous site per year. The rate of synonymous substitution is also variable among genes; the highest rate is three to f
PNAS Vol. 95, Issue 22, 12956-12960, October 27, 1998 S A. Peterson, ..., Jeffrey W. KellyInsoluble protein fibrils resulting from the self-assembly of a conformational intermediate are implicated as the causative agent in several severe human amyloid diseases, including Alzheimer's disease, familial amyloid polyneuropathy, and senile systemic amyloidosis. The latter two diseases are associated with transthyretin (TTR) amyloid fibrils, which appear to form in the acidic partial denaturing environment of the lysosome. Here we demonstrate that flufenamic acid (Flu) inhibits the conformational changes of TTR associated with amyloid fibril formation. The crystal structure of TTR complexed with Flu demonstrates that Flu mediates intersubunit hydrophobic interactions and intersubunit hydrogen bonds that stabilize the normal tetrameric fold of TTR. A small-molecule inhibitor that stabilizes the normal conformation of a protein is desirable as a possible approach to treat amyloid diseases. Molecules such as Flu also provide the means to rigorously test the amyloid hypothesis, i.e., the apparent causative role of amyloid fibrils in amyloid disease.
The accumulation of insoluble protein fibrils in human tissue is a common feature of neurodegenerative disease . In many cases the protein's native conformation is destabilized by a genetic mutation or other environmental factors, typically resulting in a beta-sheet-rich conformational intermediate. These intermediates self-assemble into amyloid fibrils, such as the fibrils found in patients with the transthyretin (TTR)-associated amyloid diseases familial amyloid polyneuropathy (FAP) and senile systemic amyloidosis (SSA). Transthyretin is found in plasma and cerebrospinal fluid and is composed of four identical 127-amino acid -sheet-rich subunits. The tetrameric structure binds and transports thyroxine (T4) and the retinol binding protein).
Previous biophysical studies demonstrated that the mechanism of TTR amyloid fibril formation requires tetramer dissociation to a monomeric conformational intermediate. This conformational intermediate, generated under conditions simulating the pH of a lysosome (5.5), self-assembles, affording amyloid fibrils. Based on fiber diffraction and cryoelectron microscopy studies, the generated amyloid fibril is 130 ‰ in diameter and is made up of four parallel protofilaments oriented in a square section array, each having an apparent cross-beta-helical structure .
The age of onset of FAP appears to be directly correlated to both the destabilizing effect of a given mutation on TTR tetramer stability and the increased rate of denaturation to the monomeric amyloidogenic intermediate. Recent studies indicate that amyloidosis caused by the V122I TTR mutation, present in 2.2% of the African American population, is associated with late-onset heart disease in this population.
We recently reported that thyroid hormone and derivatives thereof (e.g., 2,4,6-triiodophenol) strongly stabilize the normal native conformation of TTR and inhibit wild-type, V30M, and L55P amyloid formation under partially denaturing conditions simulating lysosomal acidity
Compounds whose structures complement the known binding site of TTR were screened as possible inhibitors by using established amyloid fibril assays including a light-scattering assay and a quantitative Congo red fibril-formation assay. Screening allowed us to identify several bisarylamine inhibitors including the nonsteroidal antiinflammatory drug Flu, which binds and stabilizes the nonamyloidogenic tetramer.
A small-molecule therapeutic strategy is highly desirable in comparison to the surgical strategy currently used to treat eligible FAP patients, where the FAP-associated TTR gene is replaced by the wild-type gene via liver transplantation. Currently, there is no effective treatment for SSA, which should be amenable to management by using the approach described within. Perhaps most importantly, a small-molecule inhibitor strategy makes it practical to further evaluate the amyloid hypothesis. Even though there is an overwhelming amount of circumstantial evidence favoring the amyloid hypothesis, it remains to be demonstrated that the inhibition of fibrils will prevent disease onset
Structure 1996 Aug 15;4(8):989-98 Blake C, Serpell LAmyloid diseases, which include Alzheimer's disease and the transmissible spongiform encephalopathies, are characterized by the extracellular deposition of abnormal protein fibrils derived from soluble precursor proteins. Although different precursors seem to generate similar fibrils, no adequate molecular structure of amyloid fibrils has been produced using modern techniques. Knowledge of the fibril structure is essential to understanding the molecular mechanism of
The structure of amyloid fibrils from patients with familial amyloidotic polyneuropathy (FAP), which are derived from transthyretin (TTR) variants, has been investigated by fibre diffraction. For the first time a significant high-angle diffraction pattern has been observed showing meridional reflections out to 2 A resolution. This pattern was fully consistent with the previously reported cross-beta structure for the fibril, but also reveals a new large scale fibre repeat of 115 A. We interpret this pattern as that of a repeating unit of 24 beta strands, which form a complete helical turn of beta sheet about an axis parallel to the fibre axis, composed of four beta sheets related by a single helix axis coincident with the fibre axis.
Amyloid fibrils have a novel molecular structure consisting of beta sheets extended in regular helical twists along the length of the fibre. This implies that the polypeptide chains in the fibres are hydrogen-bonded together along the entire length of the fibres, thereby accounting for their great stability. The proposed structure of the FAP fibril requires a TTR building block that is structurally different from the native tetramer. This is likely to be either a monomer or dimer with reorganized or truncated beta sheets, suggesting that amyloid formation may require significant structural change in precursor proteins.

Guardian By James Meikle Wednesday October 28, 1998The struggle to identify, understand and treat human BSE moved up a gear yesterday with the announcement of an international research centre to look at the disease. The programme of the London unit will include developing tests on blood and tonsils to help early diagnosis of the fatal condition, and warning the Government if the disease becomes epidemic.
The centre has been guaranteed long-term funding. It will co-ordinate and support other researchers, and also work on other diseases thought to be caused by the prions, or rogue proteins which destroy their healthy neighbours. The unit will be headed by John Collinge, of St Mary's Hospital and Imperial College, London, whose research group is already a world leader. Another specialist, Charles Weissman from Zurich, will join the team next March.
At first, new laboratories will be built at Professor Collinge's base at St Mary's, but another London site is being considered for the unit, which will be largely funded through the government's Medical Research Council.
Prof Collinge said yesterday: "I have tried to build a critical mass of people to tackle the problem of human prion diseases. Until recently we have had to weld together a lot of separate research grants... and we had reached the point where you don't do any science anymore, you write grant applications."
The unit will have about 60 staff. Early work will include developing tonsil checks for potential victims of human bovine spongiform encephalopathy, officially known as new variant Creutzfeldt-Jakob disease, to see whether the prions are present. Prof Collinge said [tonsil] tests on about 20 patients so far had been positive. These tests provide far less of a shock to the system than brain biopsies, which cannot give final confirmation of human BSE. This has to wait until a brain examination after death.
In addition, researchers have begun collecting thousands of tonsils removed from normal patients in routine operations to see if they can find the proteins. Prof Collinge hoped he would find none, but "failure would tell scientists nothing reassuring, while small numbers would be worrying". Even one in a 1,000 might indicate 50,000 of the country's 50 million population suffering the disease.
Twenty-nine people have so far probably died from eating infected beef in the late 1980s, but Prof Collinge said: "I would not be reassured by the small number of cases so far. It is an extremely long incubation period for humans."
The unit will seek other blood-based, and trustworthy human BSE tests - considered vital to protect transfusions - and drugs to combat the so-far incurable disase.
Genome Res 1998 Oct;8(10):1022-1037 Lee IY, Westaway D, Smit AFA, Wang K, Seto J, Chen L,... Yao H, Prusiner SB, Hood LE[Comment (webmaster): This is a very important contribution. Preliminary results were announced in August 1996 and discussed here earlier in detail. GenBank accession numbers U29185 (human), U29186 (mouse), and U67922 (sheep).] ]
The prion protein (PrP), first identified in scrapie-infected rodents, is encoded by a single exon of a single-copy chromosomal gene. In addition to the protein-coding exon, PrP genes in mammals contain one or two 5'-noncoding exons. To learn more about the genomic organization of regions surrounding the PrP exons, we sequenced 10(5) bp of DNA from clones containing human, sheep, and mouse PrP genes isolated in cosmids or lambda phage. Our findings are as follows:
(1) Although the human PrP transcript does not include the untranslated exon 2 found in its mouse and sheep counterparts, the large intron of the human PrP gene contains an exon 2-like sequence flanked by consensus splice acceptor and donor sites.
(2) The mouse Prnpa but not the Prnpb allele found in 44 inbred lines contains a 6593 nucleotide retroviral genome inserted into the anticoding strand of intron 2. This intracisternal A-particle element is flanked by duplications of an AAGGCT nucleotide motif.
(3) We found that the PrP gene regions contain from 40% to 57% genome-wide repetitive elements that independently increased the size of the locus in all three species by numerous mutations. The unusually long sheep PrP 3'-untranslated region contains a "fossil" 1.2-kb mariner transposable element.
(4) We identified sequences in noncoding DNA that are conserved between the three species and may represent biologically functional sites.
2 Nov 98 GenBank release Katherine O'Rourke et alComment (webmaster):
Three white-tailed deer sequences were deposited today in Genbank, for mature protein (Odocoileus virginianus AF091558, AF091560 , AF091559 ). They represent sequences from 5 deer with CWD and 5 without. The CWD deer were homozygous for 96G-138S or heterozygous with 96G-138N. The third allele is 96S-138S. All 3 alleles were seen in the small unaffected group. They will be doing a larger population study after finishing mule deer. It is not known whether 96G-138N participates in plaque.
The serine at codon 96 is an unusual change but, as noted, it was found in unaffected animals.. The only variation to glycine at this position in 112 prion sequences is alanine in Ateles paniscus, a new world monkey; also 3 glycines have become 2 in ungulates. The role of this residue is not known.
Serine is wildtype at codon 138, though fallow deer, Dama dama, is also asparagine, suggesting this polymorphism appeared some time back in this lineage, though I don't recall it in elk or red deer. It is 135 in human and mouse numbering, not a recognized hydrogen bond donor or acceptor sidechain, nor one of the pronounced ser-asn toggle codons (though when, as here, lots of individual animals are sequenced, more polymorphic codons appear.)
Based on sheep and scrapie, one might suspect high susceptibility alleles in cervids with CWD. However 96G-138S is wildtype, so the finding of CWD in homozygotes and heterozygotes is turned around from what one "wants" namely, CWD in 96S-138N. Under like-like, 96G-138S favors, indecisively, CWD acquired from sheep (or cattle) over being genetically determined in deer. However, the rare deer herd with familial CWD cannot be ruled out and might even be picked up with more sequencing. One supposes in vitro conversion studies are underway to determine susceptibility of cattle and sheep to various deer CWD alleles (and vice versa).
The lack of a fourth allele, 96S-138N, so far suggests 96S arose in 138S and has not recombined in with 138N to any great degree. This is better than the situation with linc and sinc mice which are double mutants just now being separated for effects on incubation time. In other words, there may be enough data to indicate which deer alleles confer susceptibility, though there is always the question of whether the animals were equally exposed, whether they have equivalent regulation of production, and how to determine population statistics.
They plan to report on the signal and GPI regions soon. These are important because some change here could conceivably affect levels or location of mature protein; MVKSHIGsWiLVLFVAmWSDvGL and YYQrGA.SvILFSSPPVILLISFLIFLIVG are expected. Let us hope that some sequence data at the exon 3 join is also provided; attttgcagAtAAGTCATCatg is expected. Position 2 could be polymorphic for G and conceivably effect splicing efficiency. Human, sheep, and goat are the only species known with G at this position.
These species are the first wild animals for which large series of individuals are to be sequenced. I see a lot of potential interest in what turns up as well as what does not turn up, for understanding normal prion structure/function. It is a poor idea to only sequence a single individual of a species. The mindset is such with sequencing human prion that alleles are missed because of only looking for certain known ones (self-fulfilliing prophecy).
>Odocoileus virginianus AF091558 O'Rourke allele 96G-132M-138S tgcaagaagcgaccaaaacctggaggaggatggaacactggggggagccgatacccggga C K K R P K P G G G W N T G G S R Y P G cagggaagtcctggaggcaaccgctatccacctcagggagggggtggctggggtcagccc Q G S P G G N R Y P P Q G G G G W G Q P catggaggtggctggggccaacctcatggaggtggctggggtcagccccatggtggtggc H G G G W G Q P H G G G W G Q P H G G G tgggggcagccacatggtggtggaggctggggtcaaggtggtacccacagtcagtggaac W G Q P H G G G G W G Q G G T H S Q W N aagcccagtaaaccaaaaaccaacatgaagcatgtggcaggagctgctgccgctggagca K P S K P K T N M K H V A G A A A A G A gtggtagggggccttggtggctacatgctgggaagtgccatgagcagacctcttatacat V V G G L G G Y M L G S A M S R P L I H tttggcaacgactatgaggaccgttactatcgtgaaaacatgtaccgttaccccaaccaa F G N D Y E D R Y Y R E N M Y R Y P N Q gtgtactacaggccagtggatcagtataataaccagaacacctttgtgcatgactgtgtc V Y Y R P V D Q Y N N Q N T F V H D C V aacatcacagtcaagcaacacacagtcaccaccaccaccaagggggagaacttcaccgaa N I T V K Q H T V T T T T K G E N F T E actgacattaagatgatggagcgagttgtggagcaaatgtgcatcacccagtaccagaga T D I K M M E R V V E Q M C I T Q Y Q R gaatcccaggct E S Q A >Odocoileus virginianus AF091559 white-tailed deer O'Rourke allele 96G-132M-138N tgcaagaagcgaccaaaacctggaggaggatggaacactggggggagccgatacccggga C K K R P K P G G G W N T G G S R Y P G cagggaagtcctggaggcaaccgctatccacctcagggagggggtggctggggtcagccc Q G S P G G N R Y P P Q G G G G W G Q P catggaggtggctggggccaacctcatggaggtggctggggtcagccccatggtggtggc H G G G W G Q P H G G G W G Q P H G G G tgggggcagccacatggtggtggaggctggggtcaaggtggtacccacagtcagtggaac W G Q P H G G G G W G Q G G T H S Q W N aagcccagtaaaccaaaaaccaacatgaagcatgtggcaggagctgctgccgctggagca K P S K P K T N M K H V A G A A A A G A gtggtagggggccttggtggctacatgctgggaagtgccatgaacagacctcttatacat V V G G L G G Y M L G S A M N R P L I H tttggcaacgactatgaggaccgttactatcgtgaaaacatgtaccgttaccccaaccaa F G N D Y E D R Y Y R E N M Y R Y P N Q gtgtactacaggccagtggatcagtataataaccagaacacctttgtgcatgactgtgtc V Y Y R P V D Q Y N N Q N T F V H D C V aacatcacagtcaagcaacacacagtcaccaccaccaccaagggggagaacttcaccgaa N I T V K Q H T V T T T T K G E N F T E actgacattaagatgatggagcgagttgtggagcaaatgtgcatcacccagtaccagaga T D I K M M E R V V E Q M C I T Q Y Q R gaatcccaggct E S Q A >Odocoileus virginianus AF091560 white-tailed deer O'Rourke allele 96S-132M-138S tgcaagaagcgaccaaaacctggaggaggatggaacactggggggagccgatacccggga C K K R P K P G G G W N T G G S R Y P G cagggaagtcctggaggcaaccgctatccacctcagggagggggtggctggggtcagccc Q G S P G G N R Y P P Q G G G G W G Q P catggaggtggctggggccaacctcatggaggtggctggggtcagccccatggtggtggc H G G G W G Q P H G G G W G Q P H G G G tgggggcagccacatggtggtggaggctggggtcaaagtggtacccacagtcagtggaac W G Q P H G G G G W G Q S G T H S Q W N aagcccagtaaaccaaaaaccaacatgaagcatgtggcaggagctgctgccgctggagca K P S K P K T N M K H V A G A A A A G A gtggtagggggccttggtggctacatgctgggaagtgccatgagcagacctcttatacat V V G G L G G Y M L G S A M S R P L I H tttggcaatgactatgaggaccgttactatcgtgaaaacatgtaccgttaccccaaccaa F G N D Y E D R Y Y R E N M Y R Y P N Q gtgtactacaggccagtggatcagtataataaccagaacacctttgtgcatgactgtgtc V Y Y R P V D Q Y N N Q N T F V H D C V aacataacagtcaagcaacacacagtcaccaccaccaccaagggggagaacttcaccgaa N I T V K Q H T V T T T T K G E N F T E actgacattaagatgatggagcgagttgtggagcaaatgtgcatcacccagtaccagaga T D I K M M E R V V E Q M C I T Q Y Q R gaatcccaggct E S Q A
Schroder B, Groschup M, Hunsmann G, Bodemer W Biochem Biophys Res Commun 1998 Oct 20;251(2):423-8".... Distinct alterations of transcriptional regulation during disease progression could not be observed. The regulation of transcription 5' and 3' to the previously described cap sites of the prion gene mRNA as well as usage of internal short ORF's was investigated. We identified a mRNA species which is expressed differentially in prion-infected mice and in N2A cells. This mRNA is detectable neither in uninfected mice nor in early stages of the disease. The novel mRNA contains two short open reading frames which encode two small peptides with a calculated molecular weight of 2.1 kDA and 0.7 kDa. These peptides were also found to be expressed in vitro and in vivo."
Comment (webmaster):
What Does this mean? These molecular weights amount to 6 and 18 amino acids, rather short but conceivably neuro-peptides. The abstract should have given them as well as the cap position relative to a GenBank number. Vertebrate mRNA has a 7-methyl G 5'-5' cap and 2'-O methylated end two base; these are not annoted in any GenBank prion entry. It is not clear what late production means, it could just be a breakdown of celllular regulation rather than a significant induced response to disease.
Proc Natl Acad Sci U S A 1998 Oct 27;95(22):13239-13241 with figure Cervenakova L, Goldfarb LG, Garruto R, Lee HS, Gajdusek DC, Brown PThe PRNP polymorphic (methionine/valine) codon 129 genotype influences the phenotypic features of transmissible spongiform encephalopathy. All tested cases of new variant Creutzfeldt-Jakob disease (nvCJD) have been homozygous for methionine, and it is conjectural whether different genotypes, if they appear, might have distinctive phenotypes and implications for the future "epidemic curve" of nvCJD. Genotype-phenotype studies of kuru, the only other orally transmitted transmissible spongiform encephalopathy, might be instructive in predicting the answers to these questions.
We therefore extracted DNA from blood clots or sera from 92 kuru patients, and analyzed their codon 129 PRNP genotypes with respect to the age at onset and duration of illness and, in nine cases, to detailed clinical and neuropathology data. Homozygosity at codon 129 (particularly for methionine) was associated with an earlier age at onset and a shorter duration of illness than was heterozygosity, but other clinical characteristics were similar for all genotypes. In the nine neuropathologically examined cases, the presence of histologically recognizable plaques was limited to cases carrying at least one methionine allele (three homozygotes and one heterozygote).
If nvCJD behaves like kuru, future cases (with longer incubation periods) may begin to occur in older individuals with heterozygous codon 129 genotypes and signal a maturing evolution of the nvCJD "epidemic." The clinical phenotype of such cases should be similar to that of homozygous cases, but may have less (or at least less readily identified) amyloid plaque formation.

Comment (webmaster):
This is a very short paper that predicts, based on kuru results, that nvCJD will likely occur after the 'leading edge' in val/val and met/val patients with similar recognizable phenotype to met/met, though perhaps shifted towards older people and slower disease course, at their appearance allowing more meaningful predictive modeling of the epidemic overall extent and duration. They did not sequence any kuru prion genes here but instead looked at a 169-bp fragment of the PRNP gene spanning codons 94 through 150; the ATG/GTG polymorphism at codon 129 was screened with endonuclease MaeII.
Iatrogenic CJD has a longer period of latency between infection and the onset of symptoms in heterozygotes, but otherwise the clinicopathological picture of CJD is the same as well. So they think nvCJD heterozygotes will not pose a problem in recognition or diagnosis.
These musings don't directly address effects of strain type. Kuru is a particular strain of sporadic CJD; iatrogenic CJD may be roughly a mix of15% familial and 85% sporadic so numerouse strains, few cases, no comparability. Whether kuru originated [not discussing passage here] from sporadic CJD, familial CJD, or TSE in pigs (or some other animal) has not been settled. nvCJD so far seems to be a single strain originating from a single strain of BSE.
Phenotype won't necessarily be the same: D178N and F198S etc. have very different outcomes depending on the other allele; the oral route of kuru/nvCJD is unlikely to be that determinative. Met/met coming first might be predictable under the like-like principle from cows being met/met. Val/val comes before met/val for nvCJD because after priming the pump, host genotype provides all material and the like-like principle comes to rule . This wasn't commented on but they seem to have a lot more valine in New Guinea than in Europe or Japan plus the patient set was not in Hardy-Weinberg equilibrium, ie the heterozygotes were depleted by a factor of 2. [Lifespan is short there in any event.]
M alleles 79 = 43% V alleles 105 = 57% MM to VV 1:1.7 expected; 1:1.5 found 18% MM expected, 17 cases 33% VV expected, 30 cases 49% MV expected, 45 cases
J Neuropathol Exp Neurol 1998 Oct;57(10):979-88 Piccardo P, Dlouhy SR, ... Pocchiari M, Brown P, Gibbs CJ Jr, Gajdusek DC, Bugiani O, Ironside J, Tagliavini F, Ghetti BGSS, a cerebello-pyramidal syndrome associated with dementia and caused by mutations in the prion protein gene (PRNP), is phenotypically heterogeneous. The molecular mechanisms responsible for such heterogeneity are unknown. Since we hypothesize that prion protein (PrP) heterogeneity may be associated with clinico-pathologic heterogeneity, the aim of this study was to analyze PrP in several GSS variants.
Among the pathologic phenotypes of GSS, we recognize those without and with marked spongiform degeneration. In the latter (i.e. a subset of GSS P102L patients) we observed 3 major proteinase-K resistant PrP (PrPres) isoforms of ca. 21-30 kDa, similar to those seen in Creutzfeldt-Jakob disease. In contrast, the 21-30 kDa isoforms were not prominent in GSS variants without spongiform changes, including GSS A117V, GSS D202N, GSS Q212P, GSS Q217R, and 2 cases of GSS P102L.
This suggests that spongiform changes in GSS are related to the presence of high levels of
these distinct 21-30 kDa isoforms. Variable amounts of smaller, distinct PrPres isoforms of ca. 7-15 kDa were seen
in all GSS variants. This suggests that GSS is characterized by the presence PrP isoforms that can be partially cleaved
to low molecular weight PrPres peptides.
Comment(webmaster):
These are evidently two new human alleles. One presumes that they are new prion mutations that turned up during screening of GSS patients. Could people please stop calling GSS a disease or pick a genotype for it? GSS is a subset of CJD with no deep underlying definition or common ground -- no wonder we get paper after paper wrestling with 'phenotypic variability.' Should hemotologists start lumpng dozens of unrelated hemoglobinopathies together based on unreliable and superficial phenotypic groupings?
Both D202N and Q212P are found in alpha helix 3 in the mouse and hamster nmr structures. D202 is an invariant residue in mammals (but E in birds) just past the 2nd glycosylation site, hydrogen bonded to Y149, Y157, T199, and T199 amide. Q212 is also strongly invariant (though deleted in birds) just prior to the second cysteine of the disulphide and hydrogen bonded to T216. E200K R208H V210I Q217R M232R are the other known mutations in this vicinity .
manlgcwmlvlfvatwsdlglcKKRPKPGGWNTGGSRYPGQGSPGGNRYPPQGGGGWGQPHGGGWGQPHGGGWGQPHGGGWGQPHGGGWGQGGGTHSQWNKPSKPKTNMKHMAGAAAAGAVVGGLGGYMLGSAMSRPIIHFGSDYEDRYYRENMHRYPNQVYYRPMDEYSNQNNFVHDCVNITIKQHTVTTTTKGENFTETDVKMMERVVEQMCITQYERESQAYYQRGSsmvlfssppvillisfliflivg
Donald L. Price, Sangram S. Sisodia, David R. Borchelt Science. 1998 Nov 6;282(5391):1079-1083. Hardy J, et al. Science.1998 Nov 6;282(5391):1075-1079.These are two nice reviews in the 7 Nov 98 issue of Science. They mainly covers Alzheimer's disease, amyotrophic lateral sclerosis, Huntington, and Parkinson's disease with the odd mention of prion disease. The first review provides an overview of transgenic mouse models. At the bottom is a graphic from a 10 Nov 98 PNAS article asserting that beta-amyloid 10-35 forms in-register parallel beta sheet:


9 Nov 98 webmasterDouble mutants: is disease onset shorter or the same? Most genetic TSE is autosomal dominant, that is, patients are heterozygous, say for D178N, (never mind further complications from codon 129) but:
-- Pocchiari found a del R2 trans to a V210I central Italian family
-- Perry found a del R2 in an Alabama FAD, parent R2/R34
-- Yamada found a del R2 in a Japanese family transto P105L
-- Masullo found a homozygous del R2 in an Italian, adopted
-- Vnecak-Jones found a del R34 mid-Tennessee with E200K
-- Laplanche saw a del R34 in a Tunisian E200K family
-- Bosque saw a del R34 in a Tennessee family with D178N
-- Cervenakova saw a del R34/R3g34 in an African-Amer family
-- Ghetti writes in 1996, 'no homozygous F198S has yet been seen in the Indiana kindred'
-- Hitoshi found a V180I M232R double mutation in an 84 year old Japanese man
Tranchant in Rev Neurol (Paris) 1991;147(4):274-8 found a double mutant A117V in a family of Alsatian origin in all patients analyzed and in 10 healthy family members leading to loss of the restriction site PvuII and to the replacement of an alanine by a valine, a litle confusing since GCA to GTA is the usual A117V, GCA to GCG the usual silent PvuII loss. Perhaps what is meant is simply A117V in the background of the PvuII polymorphism, ie the family is heterozygous for ala/val at codon 117. The full text may give the age of the 10 healthy family members. This mutation affects center of the palindromic region.
Thus the mutation was not homozygous, it simply took place in a polymorphic background of PvuII which occures in 2% or so of the population [or 1 homozygotes in 2,500), ie they started at GCG on one chromosome and ended with GTG, with enhanced probablility as a classic CpG event.
PvuII was once upon a time a mutation but today it is a common polymorphism presumbably through some accident of genetic drift. I see PvuII as very weakly deleterious even though it is silent because it creates a CpG hotspot with enhanced 'sideways' mutation rate at conserved codon position 2 (which is exactly what happened in this family; PvuII are at 4x elevated risk for A117V. Why not A117E or A117G? -- they are transversions). The initial alanine codon is used in humans at 153 per 10,000 codons whereas the resultant is strongly depleted at 71.
The codon 117 human polymorphism PvuII is not a once-dominant allele now on its way out: it is not found in any other species of great apes nor in old world monkeys. In 101 sequences, 80 species were GCA, whereas GCG was found only in new world monkeys and hamsters-gerbil, and rabbit. GCC was used by 3 species, GCT by 2.
Gabizon observes in Am J Hum Genet 1993 Oct;53(4):828-35 that 'The identification of three Libyan Jews homozygous for the Lys200Arg mutation suggests frequent intrafamilial marriages, a custom documented by genealogical investigations." The full text states that there was "no substantial differences in the clinical course and age at disease onset were observed when patients homozygous for K200K." [pg 832]. The original mutation seems to have occurred on the M129 allele as all K200 were found in this setting [thus no V129V E200K exists though M129V K200E is common].
However, only 1 homozygote was really studied, a 42 year old patient with M129M. Age of onset was in fact anomalously early as the mean age of onset was 56 and the patient was the youngest of 18 M129M patients in the sample. [One case with age of onset 35 had M129V.] Table 2 refers to 2 inferred ancestral homozygotes, one an individual with a negative spouse but 5/5 carrier children and a second with 3/3 carrier children. The authors write, "unfortunately, no tissue for genotyping from these probable homozygotes was available." [pg 830]. The odds of homozygosity are 1/32 and 1/8, not statistically signficant as dozens of families were considered.
Hsiao observed in N Engl J Med 1991 Apr 18;324(16):1091-7 that 'One patient was homozygous for the lysine mutation [E200K], and her clinical course did not differ from that of the patients heterozygous for the mutation.... The similarity of the clinical courses of the patient homozygous for this mutation and the patients heterozygous for it argues that familial Creutzfeldt-Jakob disease is a true dominant disorder. ' This case probably is probably included in the 1993 study.
It seems like the single K200K homozygotes is all that is left. There may be others in Israel or Slovakia. These are worth a careful review for earlier age of onset etc. because a lot of the models envision mass-action driven equilibrium and gene dosage effects are clearly seen in mice. But perhaps E200 is readily recruited in this form of the disease so it doesn't much matter. K200K may affect normal function so the early medical history of these patients is of considerable interest.
Can any readers contribute more reported cases of double or compound mutations?