Prion disease
Mad Cow Home ... Best Links ... Search this site

Verify your contact information
Re-doubling of doppel-prion pair
Six new human doppel transcripts
Flexible region 104-113 studied by epitope-antibody xray
Optimizing prion immunohistochemistry
Sheep reference alleles: 14 with K176N
Peripheral neuron infection varies
Statistical Aspects of BSE and vCJD: Models for Epidemics
Lancet editor threatened by Royal Society food lackeys

Verify your contact information

 
Dr. Steven Dealler has just spent a week gathering up names and current contact information of researchers and others actively involved in TSE research and medicine.  This is a major
resource with close to 400 names, addresses, faxes, phones, and emails..

He would like people to inspect their entry and email him any corrections.

The UK web site may not work at this moment for people in the US because of widespread ISP provider problems in Britain. The addresses at posted here for now. Do not write this web site with corrections; write deal@airtime.co.uk.

Contact information for researchers maintained by this web site will be collated with that of Dealler after corrections have been assimilated. Information from both the Tubingen and DC meetings will also be incorporated.

Remember to always include your email on GenBank postings as well as corresponding author in print publications in a way that will display in Medline abstracts.

Re-doubling of doppel-prion pair

1 Nov 99 webmaster opinion
It is very clear from analysis of the full set of expressed sequence tags that human doppel will be regulated quite differently that mouse doppel [see graphic below]. Recall also human prion exon 2 never seems to be expressed in vivo.

Mouse strain differences (prion exon 3 splice acceptor present?) are just the tip of the iceberg in terms of incompatibilities. It may be necessary to knock in the entire 60 kb of human-doppel gene to get a relevent rodent model for human disease -- otherwise the experiment looks at the interaction of a human disease mutant with wildtype mouse doppel in a disrupted coupling setting

A decade of work by two large labs may be down the drain except for those interested in laboratory prion diseases of rodents. This is surely not a biomedical priority but nighmarish scenario of 10 years of uninterpretable experiments. Many specific mouse strains would no longer even be available for belated control experiments.

Things may be far worse that we realize -- the prion-doppel doublet is so ancient that it itself may duplicated elsewhere in the mammalian genome. Two such whole-genome duplication events are known in the mammalian lineage -- before and after the divergence from Agnatha (lamphreys).

Looking at human chromosome 4 and 5, the upper arms already have 46 pairs of paralogous proteins. Clearly, here is a remnant of a large ancient duplication. Xp11.3-11.23 is duplicated to chromosome 3 and part of this subsequently duplicated again with inversion of gene order.

Six paralogous human hyaluronidase genes are clustered on chromosomes 3p21 and 7q31 as pairs of triples. This arrangement can arise from an ancient tandem duplication, followed by unequal crossing over to give a triplet, and then a more recent syntenic duplication.

Trisomy 20p involving prion and doppel has been observed to result from inverted duplication and neocentromere formation. The short arm of chromosome 20 in a patient with dup(20p) syndrome. arose from an initial chromosome breakage at 20p11.2, followed by an inverted duplication of the distal 20p segment due to rejoining of sister chromatids and the activation of a neocentromere within 20p12. [Am J Med Genet 1999 Aug 6;85(4):403-8]

Human chromosome 20 does not match any genes known on mouse other than those on mouse chr 2 which is the known syntenic counterpart. However, the Jackson Laboratory does not track paralogues.

Other chromosomes, such as 16, have multiple intra-chromosomal duplications. This could be studied for chromosome 20p by systematically looking at all known markers (1, 2) with chr 20 specific Blast servers (1, 2). Paralogy unfortunately is hit-or-miss.

Has the human genome have another copy of the prion-doppel region on another chromosome (as part of the two genome-wide tetraploidizations) or elsewhere on chromosome 20, and if so, how would this paralogue pair interact with the pair we have now? Somewhere out there is the coding region for anti-prion minus RNA -- this is not from doppel which fails to align or hybridize to prion DNA.

How can these questions best be approached now in silico?

It is not a good idea to wait until the draft of the whole human genome is available in the spring of 2001. In theory, NCBI blasts each gene and pseudogene on each chromosome against all other chromosomes using the new chromosome specific Blast server and updates a hypothetical chromosome paralogue map monthly.

Since this is not a current service, an individual could do a fine structure version manually by taking, say, the 10 closest neighbors on each side of prion-doppel and use the all-but-chromosome-20 feature of the new human genome blast server, keeping in mind that 24 million bp of new sequence comes in each week.

It is important to stay "close in" because the sections of the chr 20 doppel may have been shuffled by inversions and transpositions. In a matter of weeks, we will have 300 kb of contiguous high quality region flanking prion-doppel to analyze for close in markers. In late August 1999, the webmaster posted the sequences of the two immediate neighbors, IPPps 3' and RSP4Xps 5'. Three other flanking genes (to be written up shortly) have also been found -- 2 are active.

Pseudogenes are important in locating chromosome 20's doppel because a second copy of a duplication may either drifts off to a paralogous function or become inactivated as redundant. There may be other mechanisms besides chromosomal rearrangement (such as reverse transcription and integration) that give rise to processed pseudogenes. Mutations arising in pseudogenes are sometimes transduced to normal alleles through gene conversion. The parent gene [defined here as the best matching homologue known] for IPP isomerase is near the upper telomere of chr 10:

 telomere
 SHGC-533  EST
 SHGC-53435  mRNA for BS69 protein
Human IPP delta isomerase:IDI1
 SHGC-11812 ESTs
 SHGC-31479 TRANS-1,2-DIHYDROBENZENE-1..
 SHGC-12403 DDH1 Dihydrodiol dehydrogenase
 SHGC-36813 Est
 SHGC-10576 Human guanine nucleotide regulatory protein
The parent gene for RSP4X is seemingly on the X chromosome (93% sequence identity); the paralogue on the Y chromosome has far lower agreement. There are other good matches to chromosome 10p11.2-10p12.1, chromosome 12p13.3 and a 6q22.1-22.33 pseudogene.

Because a meagre 2.5% of the 144 Mbp chromosome 10 has been sequenced, it is not easy to pursue the implications of having the two immediately flanking genes of prion-doppel on chr 20 map to chromosome 10.

Evolution of the vertebrate genome as reflected in paralogous chromosomal regions in man and the house mouse.

Genomics 1993 Apr;16(1):1-19
Lundin LG
Gene constellations on several human chromosomes are interpreted as indications of large regional duplications that took place during evolution of the vertebrate genome. Four groups of paralogous chromosomal regions in man and the house mouse are suggested and are believed to e conserved remnants of the two or three rounds of tetraploidization that are likely to have occurred during evolution of the vertebrates. The phenomenon of differential silencing of genes is described.

Evolution from fish to mammals by gene duplication.

Hereditas 1968;59(1):169-87
Ohno S, Wolf U, Atkin NB

Six new human doppel transcripts

2 Nov 99 webmaster research

This graphic of dbEST hits to doppel gene reflects a second generation Blast tool developed by the webmaster that is operational now, though not yet implemented by NCBI. Blast and RepeatMasker output are integrated in the Blast graphic window. The method takes less than a minute to implement manually and is described in the technical note below. It amounts to masking pesky retrotransposons and other elements in the Blast output graphic, facilitating the identification of bona fide matches.

Using this method, 6 further human doppel mRNAs of 3 new types turn up, bringing the total to 16 in 5 distinct groups, types A-E. New ones are flagged* in the list below. Even mRNAs thousands of bp downstream are most probably doppel ESTs because they are not open reading frames and lack other Blastx, Blastn nr, or dbEST matches in any species.

It is very clear from analysis of the full set of expressed sequence tags that human doppel will have complex alternative splicing of mRNA in the 3' UTR. This could be a tissue issue or cellular response to conditions.

A massive new initiative described two weeks ago by F Collins et al. in Science will focus on obtaining longer ESTs, which tend now not to reach the coding or upstream exons. The technology actually allows for 2-3 kb reads. These would have detected chimeric prion-doppel transcripts.

Human doppel EST collection
AI656950  Length = 411 401/402 (99%)+-  169-570  411-10
AL041968  Length = 494 484/485 (99%)++  161-645   1-485
AA262992  Length = 317
AI637716  Length = 31

*AA347619  Length = 257 254/257 (98%)++ 1341-1595 1-257 no retro, no other EST hits

AI655440  Length = 472 470/471 (99%) +- 2085-2555 472-2
AI337054  Length = 424 422/423 (99%) +- 2133-2555 424-2
AI288920  Length = 410 403/403 (100%)+- 2153-2555 410-8
AI242370  Length = 365 365/365 (100%)+- 2190-2554  365-1
AI825182  Length = 344 341/343 (99%) +- 2213-2555  344-2
AI758081  Length = 

*AI187842  Length = 308 305/306 (99%) +- 3080-3385 308-3  3252  3383  (8374) C  L1ME1
*W73057    Length = 277 277/277 (100%)+- 3110-3386 277-1  3252  3383  (8374) C  L1ME1
*W76645    Length = 415 155/157 (98%) +- 154-308 14-258   2710  3015  (8742) C  AluSx

*AA913922  Length = 479 475/475 (100%)++ 6209-6683   5-479 no retro, no other est hits
*AA954982  Length = 372 367/367 (100%)++ 6209-6575   6-372 no retro
Technical note:
To convert repeat masked output into a graphic that sits on top of the blast graphic to mask it. se symbol font, 4 points, [ for retro and . for sequence. These are the same width at this font size even though symbol is not generally a proportional font. When printed, these drop down to vertical line and blank of width 1 pixel, giving desired pattern of solid and blank.
1   replace repeatmasker N's with [ and remaining sequence with . in Word 
2.  paste into a  photoshop b/w graphic 4 pixels high and width the length of the sequence. 
3.  take screenshot of blast graphic with ESTs or whatever underneath and measure width of sequence using wand.
4.  reduce width  of retro graphic to match blast width using image size adjust in photoshop, keeping height same.
5.  paste, add retro names.
6.  voila

Peripheral neuron infection varies

1 Nov 99 Medline

Disease associated prion protein may deposit in the peripheral nervous system in human transmissible spongiform encephalopathies.

Acta Neuropathol (Berl) 1999 Sep 27;98(5):458-460
Hainfellner JA, Budka H
There is increasing evidence indicating involvement of the peripheral nervous system (PNS) in the pathogenesis of transmissible spongiform encephalopathies (TSEs). Immunocytochemically detectable deposits of TSE-specific abnormal prion protein (PrP(sc)) are considered as a surrogate marker for infectivity. We used anti-PrP immunocytochemistry to trace PrP(sc) deposition in spinal and enteric ganglia, and peripheral nerve in Creutzfeldt-Jakob disease (CJD), Gerstmann-Straussler-Scheinker disease (GSS), and fatal familial insomnia. Discrete PrP(sc) deposits were detectable only in a few posterior root nerve fibers in an adaxonal location in one of nine CJD and the one GSS patients examined. Follicular dendritic cells of the gut and enteric nervous system were not labeled. Thus, PrP(sc) may spread to the PNS in different forms of human prion disease. In contrast to our observations in experimental scrapie (Groschup et al., Acta Neuropathol, this issue), the deposits were scant. Possible explanations for this discrepancy comprise strain difference, or centripetal (experimental scrapie) versus centrifugal (sporadic and genetic human prion diseases) spread of PrP(sc), resulting in different patterns and amounts of PrP(sc) accumulation in the PN

Deposition of disease-associated prion protein involves the peripheral nervous system in experimental scrapie.

Acta Neuropathol (Berl) 1999 Sep 27;98(5):453-457 
Groschup MH, Beekes M, McBride PA, Hardt M, Hainfellner JA, Budka H
There is some evidence that the peripheral nervous system (PNS) is involved in the pathogenesis of transmissible spongiform encephalopathies (TSEs). The TSE-specific abnormal prion protein (PrP(sc)) is considered as surrogate marker for infectivity. We traced the deposition of PrP(sc) by immunocytochemistry in sheep and hamsters inoculated intraperitoneally with scrapie. The trigeminal, dorsal root, celiac, thoracic, and nodose ganglia contained ganglion cells and fewer satellite cells with prominent granular PrP(sc) deposition. As a novel deposition pattern, punctate deposits in adaxonal location were seen along nerve fibers of peripheral nerve adjacent to ganglia. Such prominent involvement of the PNS in two different experimental scrapie models emphasizes the need to consider the PNS in natural scrapie and other TSEs including bovine spongiform encephalopathy as potential source of infectivity.

Statistical Aspects of BSE and vCJD: Models for Epidemics

New book by C A Donnelly and N M Ferguson, University of Oxford
Dust jacket: Bovine spongiform encephalopathy (BSE) or "mad cow disease," first diagnosed in late 1986, is transmitted through feed, indirect horizontal transmission, apparently maternally and possibly horizontally, through cattle-to-cattle contact or a contaminated environment. With no ante-mortem test yet developed, the only information available about BSE is from case surveillance and a limited number of experiments. Only through careful and rigorous modeling and analysis can reliable estimates of past infection and predictions of future cases be made.

The modeling developed for BSE utilizes a range of techniques from statistics, ecology, and demography that is of interest both as a case study and for providing tools for other modeling projects. Statistical Aspects of BSE and vCJD: Models for Epidemics presents the general methodology required for thorough analysis and modeling of novel long incubation diseases with largely unknown etiology.

Comment (author to listserve):
"The analysis of population-level data can never prove that indirect horizontal transmission never happens but the results provide no evidence that such transmission could sustain the epidemic.

Since our book was completed this spring, we did not have information about the new blood test. I am not aware of any use of it to date on the scale necessary to estimate national infection prevalence.

Our book's second chapter describes the available data on transmission routes, incubation period distributions, and genetics of TSEs (including BSE, human TSEs, and other veterinary TSEs including scrapie and TME) and discusses their relevance to BSE epidemiology.

The book provides the only comprehensive development and application of the wide range of analytical methods (drawing on the methods of mathematical biology and statistics) necessary to gain epidemiological insights into the trends in past infection incidence, prediction of future cases, the rates of maternal and horizontal transmission of the infectious agent, the processes underlying the clustering of BSE cases in herds, epidemiological determinants of the size of any future vCJD epidemic, etc.

Other upcoming publications from our group:

Donnelly CA, MaWhinney S and Anderson RM. The BSE Epidemic in British
cattle. Ecosystem Health, to appear late 1999.

Donnelly CA, Santos R, Ramos M, Galo A and Simas P. BSE in Portugal:
anticipating the decline of an epidemic. Journal of Epidemiology and
Biostatistics, to appear.

Hagenaars TJ, Ferguson NM, Donnelly CA, Ghani AC and Anderson RM. Feed-borne
transmission and case clustering of BSE. Proceedings of the Royal Society
London B, to appear.

 Ghani AC, Donnelly CA, Ferguson NM, and Anderson RM. Assessment of the prevalence of
vCJD through testing tonsils and appendixes for abnormal prion protein.
Proceedings of the Royal Society London B, to appear - first issue in January."
Dr Christl A Donnelly
Head of Statistics Unit
The Wellcome Trust Centre for the  Epidemiology of Infectious Disease
University of Oxford
South Parks Road Oxford  OX1 3FY UK
Centre, BSE Research C A Donnelly   
Phone    01865 281 244 FAX        01865 281 241
Catalog Number: C0386, ISBN: 0849303869 Price: $69.95, Publication Date: 07/21/99 To view this book, go to Amazon.com's blurb or directly to the publisher (go to Online Catalog and search for BSE)

Antibody binding defines a structure for an epitope that participates in the PrP(C)-->PrP(Sc) conformational change.

J Mol Biol 1999 Nov 5;293(4):855-863 
Kanyo ZF, Pan KM, Williamson RA, Burton DR, Prusiner SB, Fletterick RJ, Cohen FE
Comment (webmaster): This is an interesting concept, to study the conformation of an epitope by looking at the xray structure of the monoclonal that it raises when in the full length mature protein. Without copper, region 104-113 is hard to pin down in nmr. By itself, it would be floppier still. However, one of those configurations will sit in the antibody site and that is what they studied. Omega loop -- the structure found adopted --are explained below.

The X-ray crystallographic structures of the anti-Syrian hamster prion protein (SHaPrP) monoclonal Fab 3F4 alone, as well as the complex with its cognate peptide epitope (SHaPrP 104-113), have been determined to atomic resolution. The conformation of the decapeptide is an Omega-loop. There are substantial alterations in the antibody combining region upon epitope binding. The peptide binds in a U-shaped groove on the Fab surface, with the two specificity determinants, Met109 and Met112, penetrating deeply into separate hydrophobic cavities formed by the heavy and light chain complementarity-determining regions.

In addition to the numerous contacts between the Fab and the peptide, two intrapeptide hydrogen bonds are observed, perhaps indicating the structure bound to the Fab exists transiently in solution. This provides the first structural information on a portion of the PrP N-terminal region observed to be flexible in the NMR studies of SHPrP 90-231, SHaPrP 29-231 and mouse PrP 23-231. Antibody characterization of the antigenic surfaces of PrP(C) and PrP(Sc) identifies this flexible region as a component of the conformational rearrangement that is an essential feature of prion disease.

Taxonomy and conformational analysis of loops in proteins.

J Mol Biol 1992 Apr 5;224(3):685-99
Published erratum appears in J Mol Biol 1992 Oct 5;227(3):977
Ring CS, Kneller DG, Langridge R, Cohen FE
We propose a general classification scheme for loops, aperiodic segments of protein structure. In an effort to avoid the geometric complexity created by non-repeating phi psi angles, a morphologic definition that focuses upon the linearity and planarity of loops is utilized. Out of 432 loops (4 to 20 residues in length) extracted from 67 proteins, 205 are classified as linear (straps), 133 as non-linear and planar (omegas), and 86 as non-linear and non-planar (zetas). The remaining 8 are classified as compound loops because they contain a combination of strap, omega, and zeta morphologies.

We introduce a structural alphabet as a shorthand notation for describing local conformation. The symbols of this alphabet are based on the virtual dihedral angle joining four consecutive alpha carbons. The notation is used to provide a compact description of loop motifs in phosphate binding and calcium binding proteins. Since similar loop conformations form similar "words", the structural sequence facilitates the search for common structural motifs in a family of loops. Contrary to the view of loops as "random coils", we find loops to have positional preferences for amino acid residues analogous to those previously described for beta-turns.

Loops in globular proteins: a novel category of secondary structure.

Science 1986 Nov 14;234(4778):849-55
Leszczynski JF, Rose GD
The protein loop, a novel category of nonregular secondary structure, is a segment of contiguous polypeptide chain that traces a "loop-shaped" path in three-dimensional space; the main chain of an idealized loop resembles a Greek omega. A systematic study was made of 67 proteins of known structure revealing 270 omega loops. Although such loops are typically regarded as "random coil," they are, in fact, highly compact substructures and may also be independent folding units. Loops are almost invariably situated at the protein surface where they are poised to assume important roles in molecular function and biological recognition.

Antigen Retrieval in Prion Protein Immunohistochemistry

J Histochem Cytochem 1999 Nov;47(11):1465-1470 
Van Everbroeck B, Pals P, Martin JJ, Cras P
Transmissible spongiform encephalopathies are a group of neurodegenerative diseases occurring in both humans and animals and are most likely caused by prions. Neuropathological confirmation of the clinical diagnosis has been a problem because of the difficulty in epitope retrieval from formalin-fixed, paraffin-embedded brain specimens. Many different protocols for the detection of prions in brain tissue have been used. Thus far, picric and/or formic acid, steam autoclaving at 121C of sections, microwave treatment, and 4 M guanidine thiocyanate treatment have been suggested. The objective of our experiment was to obtain the standard pretreatment(s) resulting in optimal immunostaining. In the experiment, successive tissue slides of brain specimens of several Creutzfeldt-Jakob disease and control patients were stained using different combinations of pretreatments. Using densitometric analysis, several well-defined locations per section were examined and prion immunostaining was quantified.

The results showed that autoclaving is necessary for antigen retrieval and cannot be substituted by microwave treatment. The best results were obtained when the following combination was used in the specified order: 15 min saturated picric acid, 10 min steam autoclaving at 121C, 5 min 88% formic acid, and 2 hr 4 M guanidine thiocyanate at 4C.

Lancet editor threatened by Royal Society food reps

Monday November 1, 1999 The Guardian  Laurie Flynn and Michael Sean Gillard 
Comment (webmaster): Here is some absolutely disgusting behavior on the part the "Royal" Society. We would not have to look to hard to establish that members of the "Rebuttal Unit" have long been on the take from the food industry.

The same type of interference goes on in BSE research of course -- proofs of the PNAS paper of Noelle Bons (100% transmission of BSE to primates) were floated around in England and the editor was pressured not to publish it, or at least put in an unreviewed slasher comment piece in the same issue (following issue). This has been a banner year, with the editors of the NEJM and JAMA being forced out for refusing to buckle to commerce-minded doctors and now the editor of Lancet.

The editor of one of Britain's leading medical journals, the Lancet, says he was threatened by a senior member of the Royal Society, the voice of the British science establishment, that his job would be at risk if he published controversial research questioning the safety of genetically modified foods.

Richard Horton declined to name the man who telephoned him. But the Guardian has identified him as Peter Lachmann, the former vice-president and biological secretary of the Royal Society and president of the Academy of Medical Sciences.

The Guardian has been told that an influential group within the Royal Society has set up what appears to be a "rebuttal unit" to push a pro-biotech line and counter opposing scientists and environmental groups.

Dr Horton said he was called at his office in central London on the morning of Wednesday October 13, two days before the Lancet published a research paper by Arpad Pusztai, the scientist at the centre of the GM controversy. Dr Horton, editor of the Lancet since 1995, said the phone call began in a "very aggressive manner". He said he was called "immoral" and accused of publishing Dr Pusztai's paper which he "knew to be untrue".

Towards the end of the call Dr Horton said the caller told him that if he published the Pusztai paper it would "have implications for his personal position" as editor. The Lancet is owned by Reed Elsevier, one of Europe's largest scientific publishing houses. At the end of the call Dr Horton, 37, said he immediately informed his colleagues and named the caller.

Prof Lachmann, a professor of immunology at Cambridge and a Royal Society fellow for 17 years, confirmed that he rang Dr Horton on October 13 to discuss his "error of judgment" in deciding to publish the paper. He said he called Dr Horton after he had been emailed, "probably by the Royal Society", a proof of the paper. [Just look at the header on the email. Why is a copyrighted article be emailed around and who furnished an article under review to non-reviewers? -- webmaster]

However, Prof Lachmann, 67, "categorically denies" making any threat to Dr Horton during the call. "This is absolute rubbish, it would never have crossed my mind," he said. "I didn't accuse him of being immoral. I said there were moral difficulties about publishing bad science. I think I probably suggested to him that he knew the science was very bad. They [the Lancet] knew it was bad science, whether you call that untrue or not, I don't think I used the word untrue."

Prof Lachmann's call to Dr Horton was preceded by a series of controversial interventions by the society on the Pusztai affair. While vice-president of the society, Prof Lachmann chaired a special working group on GM plants for food use last year which endorsed their "potential for real benefits" but recognised the need for further research and monitoring. The Royal Society says that its report is now being used as a "source document" by the government.

The Lachmann group report was published in September 1998, a month after Dr Pusztai first expressed his concerns on British TV about their safety, questioning government regulatory procedures. Dr Pusztai's employer, the Rowett Institute, had authorised the interview, but it seized his data, forced him to retire and banned him from speaking out.

In February, Prof Lachmann was one of the 19 Royal Society fellows who attacked Dr Pusztai's work in an open letter. He and other key Royal Society fellows have since been at the forefront of defending GM technology and extolling its ability to solve world hunger and provide safer food and medicines.

Lachmann's extensive CV includes a recent consultancy to Geron Biomed, which markets the animal cloning technology behind Dolly the sheep, and a non-executive directorship for the biotech company Adprotech. Prof Lachmann is also on the scientific advisory board of the pharmaceutical giant SmithKline Beecham, which invests heavily in biotechnology. He denies any conflict of interest, arguing that his expertise in the area qualifies him to comment. [This is ludicrous. Comments are fine; conflicts must be disclosed. -- webmaster.]

The first intervention came in March when the Royal Society, which does not normally conduct peer reviews, took the unusual decision to scrutinise Dr Pusztai's work. [No data or article was ever submitted to the Royal Society. Who gave them the remit? -- webmaster]

A group of reviewers, whom the society refuses to name, concluded after examining incomplete data that it appeared to be "flawed in many aspects of design, execution and analysis".

Dr Horton wrote a Lancet editorial that month accusing the Royal Society of "breathtaking impertinence". Prof Lachmann, who was not involved in this peer review, nevertheless countered with a letter attacking the journal's position as "absurd". Dr Horton published the letter in July. At the same time, the Lancet was considering whether to peer review and publish the now famous paper by Dr Pusztai and Stanley Ewen on the effect on the gut of rats fed GM potatoes.

Dr Horton was also considering publishing a second research paper by another team of scientists. They had looked at the same GM protein used in Dr Pusztai's potatoes and found that it binds to human white blood cells. The health implications must be further researched before the GM protein is allowed into the food chain, the paper recommended.

Dr Horton said he never expected what would follow from his decision to promote scientific debate by publishing both papers. He said there was intense pressure on the Lancet from all quarters, including the Royal Society, to suppress publication. The campaign, he said, was "worthy of Peter Mandelson".

[A London correspondent explains: "Peter Mandelson is a Machiavellian Labour spin doctor called the "Prince of Darkness" by members of his own party - a name which stuck. This is because he is effectively ran 2 campaigns: one to stuff the Conservatives (e.g. instant rebuttal unit) and another to stuff the majority of Labour MPs who are rather more to the left than their leaders."]

The Guardian has learned that these interventions are taking place in an unusual context. According to a source, the Royal Society science policy division is being run as what appears to be a rebuttal unit. The senior manager of the division is Rebecca Bowden, who coordinated the highly critical peer review of Dr Pusztai's work. She joined the society in 1998, from the government biotechnology unit at the department of the environment, which controls the release of genetically modified organisms.

The rebuttal unit is said by the source to operate a database of like-minded Royal Society fellows who are updated by email on a daily basis about GM issues. The aim of the unit, according to the source, is to mould scientific and public opinion with a pro-biotech line. Dr Bowden confirmed that her main role is to coordinate biotech policy for the society, reporting to the president, Sir Aaron Klug. However, she and Sir Aaron denied it was a spin-doctoring operation. [Klug, a former protein crystallographer with no expertise in genetics or living organisms, has also been writing numerous opinion pieces. -- webmaster]

In May a leaked government memo outlined how its office of science and technology was compiling a list of eminent scientists who were on message to rebut criticism and underwrite the government's unequivocal pro-biotech line. The Guardian has established that the Royal Society was involved in trying to prevent publication of the Pusztai paper. This intervention intensified when it learnt the paper had been peer reviewed for the Lancet by six scientists, Dr Horton told the Guardian.

The only reviewer arguing against publication was John Pickett of the government-funded Institute of Arable Crops Research. Prof Pickett said that when he realised that Dr Pusztai's paper had been accepted for publication, he took his concerns to the Royal Society' s biological secretary who told him the society was already preparing a press release. [This is completely inappropriate behavior for someone involved in peer review.]

Five days before the Lancet published, an article appeared in a national newspaper in which Prof Pickett broke the protocols of peer review and publicly attacked the Lancet for agreeing to publish the Pusztai paper. Two days after the spoiler article appeared, Prof Lachmann made his phone call to the editor of the Lancet.

Dr Horton said the society had acted like a star chamber throughout the Pusztai affair. "The Royal Society has absolutely no remit to conduct that sort of inquiry."

Sir Aaron said he knew nothing about the phone call to Dr Horton and whoever spoke to the Lancet editor was not doing so on the society's behalf. However, he confirmed that the society had a proof of the Pusztai paper before the Lancet published it. [Klug's behavior has been disgraceful throughout -- his resignation is in order. -- webmaster]

Sheep reference alleles

1 Nov 99 webmaster
A new sheep allele, K176N (aac to aaa), found in the breed Sarda is now at GenBank AF195247, 771 bp, as of 25 Oct 1999, as posted by Vaccari, G. and Petraroli, R

The authors are calling it AQ176N to indicate values of its other key codons -- wild type is ARQ at codons 136, 154, and 171, the best studied allele positions. This is the 14th known point variation that has been found in sheep. Lysine is also reported in this otherwise conserved position in domestic horse (but not zebra). The adjacent asparagine readily tolerates serine and threonine substitutions. The region is not conserved in bird prion or mammalian doppel.

Humans and sheep are the species with the most number of individuals sequenced. If only three neutral alleles have been found in human (the rest seem sufficient to cause disease), then how many of the 10 sheep alleles do we expect to be neutral? About 3. Note that the distribution of sheep alleles is strongly biased towards non-synonomous changes in the 3rd quartile of the protein.

wild typealleles
M112T

A136V

A136T

M137T

S138N

L141F

R151C

R154H

Q171H

Q171R

Q171K

K176N

R211Q
atggtgaaaagccacataggcagttggatcctggttctctttgtggccatgtggagtgac
 M  V  K  S  H  I  G  S  W  I  L  V  L  F  V  A  M  W  S  D 
gtgggcctctgcaagaagcgaccaaaacctggcggaggatggaacactggggggagccga
 V  G  L  C  K  K  R  P  K  P  G  G  G  W  N  T  G  G  S  R 
tacccgggacagggcagtcctggaggcaaccgctatccacctcagggagggggtggctgg
 Y  P  G  Q  G  S  P  G  G  N  R  Y  P  P  Q  G  G  G  G  W 
ggtcagccccatggaggtggctggggccaacctcatggaggtggctggggtcagccccat
 G  Q  P  H  G  G  G  W  G  Q  P  H  G  G  G  W  G  Q  P  H 
ggtggtggctggggacagccacatggtggtggaggctggggtcaaggtggtagccacagt
 G  G  G  W  G  Q  P  H  G  G  G  G  W  G  Q  G  G  S  H  S 
cagtggaacaagcccagtaagccaaaaaccaacatgaagcatgtggcaggagctgctgca
 Q  W  N  K  P  S  K  P  K  T  N  M  K  H  V  A  G  A  A  A 
gctggagcagtggtagggggccttggtggctacatgctgggaagtgccatgagcaggcct
 A  G  A  V  V  G  G  L  G  G  Y  M  L  G  S  A  M  S  R  P 
cttatacattttggcaatgactatgaggaccgttactatcgtgaaaacatgtaccgttac
 L  I  H  F  G  N  D  Y  E  D  R  Y  Y  R  E  N  M  Y  R  Y 
cccaaccaagtgtactacagaccagtggatcagtatagtaaccagaacaactttgtgcat
 P  N  Q  V  Y  Y  R  P  V  D  Q  Y  S  N  Q  N  N  F  V  H 
gactgtgtcaacatcacagtcaagcaacacacagtcaccaccaccaccaagggggagaac
 D  C  V  N  I  T  V  K  Q  H  T  V  T  T  T  T  K  G  E  N 
ttcaccgaaactgacatcaagataatggagcgagtggtggagcaaatgtgcatcacccag
 F  T  E  T  D  I  K  I  M  E  R  V  V  E  Q  M  C  I  T  Q 
taccagagagaatcccaggcttattaccaaaggggggcaagtgtgatcctcttttcttcc
 Y  Q  R  E  S  Q  A  Y  Y  Q  R  G  A  S  V  I  L  F  S  S 
cctcctgtgatcctcctcatctctttcctcatttttctcatagtaggatag
 P  P  V  I  L  L  I  S  F  L  I  F  L  I  V  G  -  
atggtgaaaagccacataggcagttggatcctggttctctttgtggccatgtggagtgac
 M  V  K  S  H  I  G  S  W  I  L  V  L  F  V  A  M  W  S  D 
gtgggcctctgcaagaagcgaccaaaacctggcggaggatggaacactggggggagccga
 V  G  L  C  K  K  R  P  K  P  G  G  G  W  N  T  G  G  S  R 
tacccgggacagggcagtcctggaggcaaccgctatccacctcagggagggggtggctgg
 Y  P  G  Q  G  S  P  G  G  N  R  Y  P  P  Q  G  G  G  G  W 
ggtcagccccatggaggtggctggggccaacctcatggaggtggctggggtcagccccat
 G  Q  P  H  G  G  G  W  G  Q  P  H  G  G  G  W  G  Q  P  H 
ggtggtggctggggacagccacatggtggtggaggctggggtcaaggtggtagccacagt
 G  G  G  W  G  Q  P  H  G  G  G  G  W  G  Q  G  G  S  H  S 
cagtggaacaagcccagtaagccaaaaaccaacacgaagcatgtggcaggagctgctgca
 Q  W  N  K  P  S  K  P  K  T  N  T  K  H  V  A  G  A  A  A 
gctggagcagtggtagggggccttggtggctacatgctgggaagtgtcacgaacaggcct
 A  G  A  V  V  G  G  L  G  G  Y  M  L  G  S  VT T  N  R  P 
tttatacgttttggcaatgactatgaggactgttactatcatgaaaacatgtaccgttac
 F  I  R  F  G  N  D  Y  E  D  C  Y  Y  H  E  N  M  Y  R  Y 
cccaaccaagtgtactacagaccagtggatcgttatagtaaccagaaaaactttgtgcat
 P  N  Q  V  Y  Y  R  P  V  D RHK Y  S  N  Q  N  N  F  V  H 
gactgtgtcaacatcacagtcaagcaacacacagtcaccaccaccaccaagggggagaac
 D  C  V  N  I  T  V  K  Q  H  T  V  T  T  T  T  K  G  E  N 
ttcaccgaaactgacatcaagataatggagcaagtggtggagcaaatgtgcatcacccag
 F  T  E  T  D  I  K  I  M  E  Q  V  V  E  Q  M  C  I  T  Q 
taccagagagaatcccaggcttattaccaaaggggggcaagtgtgatcctcttttcttcc
 Y  Q  R  E  S  Q  A  Y  Y  Q  R  G  A  S  V  I  L  F  S  S 
cctcctgtgatcctcctcatctctttcctcatttttctcatagtaggatag
 P  P  V  I  L  L  I  S  F  L  I  F  L  I  V  G  - 

Update on deer and elk: 2 codons with amino acid variability and 8 variable nucleotide positions (so 6 silent) within Odocoileus.

g286a 1   G96S
c384t 0
g413a 2   S138N
g417a 0
t438c 0
c468t 0
c555a 0
c618t 0
Update on ruminants known to have 6 octapeptide repeat alleles:

cowBos taurus
greater kuduTragelaphus strepsiceros
giraffeGiraffa camelopardalis
gazelleGazella subgutturosa
pronghornAntilocapra americana
European bisonBison bonasus

Mad Cow Home ... Best Links ... Search this site