Analysis of the prion gene: introduction
Feature tables of mammalian prion genes
Rat prion cytochrome c pseudogene
Outgroup arbitration applied to prion promoter
Alignment of cyt c pseudogene delimited pre-exon 1
Ancestral size of intron 1
Full length alignment and analysis of cow and sheep
Supplemental resources: on-site, off-page
...Masked human prion: 13,885 bp removed, 21,637 bp left
...Masked mouse prion: 11,692 bp removed, 26,726 bp left
...Masked rat prion: 917 bp removed, 7577 bp left
...Masked sheep prion
...Masked cattle prion
Supplemental resources: off-site
...Censor Server at GIRI
...Blast services: 2 sequences, personal database, or by taxon
25 May 99 webmasterIY Lee et al. published a major article on the human, sheep, and mouse prion gene sequences in Genome Res. 1998 Oct;8(10):1022-37]. Recall that the coding part of the mammalian gene comprises some 774 nucleotides whereas these researchers sequenced 35,000 bp envelopes of these three species. Many improvements and new observations were made relative to the version that appeared in the 1996 Erice symposium, previously summarized and expanded upon at this site.
The article is well worth reading in detail. A cytochrome c processed pseudogene was observed in rat prion delimiting the promoter region; a laminin receptor pseudogene in mouse far upstream (a curious coincidence given its purported binding to prion protein); a 4.5 S rRNA pseudogene, and various SINE and LINE retrotransposons that were classified into ancestral mammalian and lineage-specific. They also reconstructed the history of intron 2, which is 9,970, 18,012, and 14,031 bp in human, mouse, and sheep, respectively. The mammalian prion gene grew longer over time on average through retrotranspositional insertional events in excess of deletional loss.
Intron 2 was 9,100 bp at the time of mammalian divergence. Since the average is 14,004 today, an extra 4,904 bp (54%) has crept in over the eons, about 50 bp per million years. This process is no doubt continuing today (viz., the IAP defective virus in some mouse strains). A more recent retrotransposon can split a previous one upon insertion. This gives a strip-and-join method of finding unrecognizeable older insertions and a way of ordering of events that supplementing point mutational rate dating techniques (as used with the Alu primate family).
SINEs and LINEs are a specialized world. The literature is immense, the sequences an acquired taste, the subtypes unending. Because retrotransposon analysis is constantly improving, the paper by Lee is not fully consistent either with their GenBank entries nor with a 15 Mar 99 analysis by retrotransposon expert, Jerzy Jurka, whose Censor Servor analyzes and annotates genes in real time. Indeed, many GenBank entries are under-annotated or mis-annotated with respect to retrotransposons.
Below, various topics are explored concerning the structure of the prion gene in more depth than was possible in the IY Lee paper, exploiting the more contemporary feature analysis by Jurka and by considering additional sequenced species. By stripping off insertional elements and pseudogenes found in particular lineages, better alignments and Blast queries are possible.
The rat cytochrome c pseudogene conveniently limits the extent of the prion promoter to 454 bp. A primitive rodent promoter can be reconstructed using repeat masking and a tree-topology driven consensus technique called outgroup arbitration, which allows resolution of most indels into either deletions or insertions and determines as well which lineage had the point mutation where sequences are different.
It turns out that in non-coding DNA, whether promoter or not, small deletions or insertions occur at roughly the same rate as point mutations. (Note these changes are 'accepted' rates, not incidence rates; only changes fixed by genetic drift and selection across the species are under consideration.) The size distribution of indels shows a rapid fall-off with increasing size; many occur in a repeat context, suggesting replication slippage.
The whole region delimited 5' by the rat pseudogene and 3' by the start of exon 2 is aligned here for all species available. Erratic changes can be understood by first aligning close pairs such as sheep and cow that present no difficulties. The human sequence can often cast a deciding vote when sheep and cow differ. Anchor regions (long conserved stretches) allow rodents to be added and localize residual uncertainty
This sets the stage for asking why exon 1 aligns so poorly between rodents and other mammals; indeed, upstream presumptive transcription start and control signals are far better preserved. The ancestral size and history of intron 1 can be deduced using rodent, primate, and artiodactyl sequences. Here, after discounting retrotransposons, non-rodents average 2,386 bp while rodents average 1,871 yet no conspicuous large deletion can be identified that accounts for the 515 bp difference.
15 May 99 GenBank U29185 human gene feature analysis by Lee et al, Censor Servor , webmasterThe table below shows that 57 retrotransposons make up 39.1% of the 35,522 bp human prion gene region sequenced. Exons 1, 2, 3 total about 991 bp or only 2.8%. That leaves the origin and function of 64% of the region unexplained.
None of the insertion events below are recent. The Alu mainly date to a period 35 million years ago when a master element was active in primates. The LINE elements were in some cases inserted prior to the mammalian radiation. Thus, these elements are not plausible human population polymorphisms. Simple sequence repeats (SSRs) are more useful markers in this regard: see Figure 1 of the Lee paper.
| Features of the human prion gene | ||||||||||
dir + + + - + - - + - - + + - - + + + + + + - + + - + + + + + - - - - + - + + + + - - - - - + - - - - + - - - - - + + 29+ | start 4 288 1626 1926 2106 2814 2962 3131 3425 5410 5839 5969 6977 7521 7960 8262 8481 8961 9246 9915 9995 10284 10417 11511 14413 14583 14752 16267 16945 17566 18029 18325 18968 19154 19597 19713 20075 20472 20618 21144 21400 21643 21928 23507 24675 28160 28247 28535 29185 29743 30816 31331 31818 33195 33343 33847 34288 Totals | stop 206 402 1685 2000 2526 2926 3118 3422 3469 5640 5965 6253 7266 7558 8260 8440 8951 9241 9349 9971 10281 10416 10757 11800 14514 14657 14952 16334 17564 18021 18302 18550 19075 19584 19708 20018 20341 20607 20663 21395 21640 21927 22898 24188 24821 28217 28534 28907 29635 30034 30998 31431 31950 33300 33592 34133 34748 35522 | bp 203 115 60 75 421 113 157 292 45 231 127 285 290 38 301 179 471 281 104 57 287 133 341 290 102 75 201 68 620 456 274 226 108 431 112 306 267 136 46 252 241 285 971 682 147 58 288 373 451 292 183 101 133 106 250 287 461 13885 39.1% | gap 81 1223 240 105 287 35 12 2 1940 198 3 723 254 401 1 40 9 4 565 23 2 0 753 2612 68 94 1314 610 1 7 22 417 78 12 4 56 130 10 480 4 2 0 608 486 3338 29 0 277 107 781 332 386 1244 42 254 154 773 21637 60.9% | feature MER74 MER3 L1P_MA2 L1P_MA2 MER65A MLT1A MLT1A Alu-Spqxz MLT1A LTR16C L1ME_ORF2 Alu-Sz Alu-Sx HERVFH21 LINE2 MER5A LINE2 Alu-Jb LINE2 MLT1G1 Alu-Sz MLT1G1 MLT1G Alu-Jo L1MD2 MIR L1ME3A MER5A L1P_MA2 L1P_MA2 L1ME_ORF2 L1ME_ORF2 L1P_MA2 LINE2 Alu-Jb LINE2 Alu-Jo Alu-Jo LINE2 L1ME_ORF2 L1PA11 L1PA15 L1ME_ORF2 LINE2 L1MB7 MER28 Alu-Sz MER28 MER88 Alu-Sq MER5A MER5A Alu-Jo SVA SVA Alu-Y MLT2B2 57 | sorted Alu-Jb Alu-Jb Alu-Jo Alu-Jo Alu-Jo Alu-Jo Alu-Spqxz Alu-Sq Alu-Sx Alu-Sz Alu-Sz Alu-Sz Alu-Y HERVFH21 L1MB7 L1MD2 L1ME3A L1ME_ORF2 L1ME_ORF2 L1ME_ORF2 L1ME_ORF2 L1ME_ORF2 L1PA11 L1PA15 L1P_MA2 L1P_MA2 L1P_MA2 L1P_MA2 L1P_MA2 LINE2 LINE2 LINE2 LINE2 LINE2 LINE2 LINE2 LTR16C MER28 MER28 MER3 MER5A MER5A MER5A MER5A MER65A MER74 MER88 MIR MLT1A MLT1A MLT1A MLT1G MLT1G1 MLT1G1 MLT2B2 SVA SVA 57 | lineage primate primate primate primate primate primate primate primate primate primate primate primate primate unknown mammalian mammalian mammalian mammalian mammalian mammalian mammalian mammalian mammalian mammalian mammalian mammalian mammalian mammalian mammalian mammalian mammalian mammalian mammalian mammalian mammalian mammalian unknown mammalian mammalian mammalian mammalian mammalian mammalian mammalian mammalian mammalian mammalian mammalian mammalian mammalian mammalian mammalian mammalian mammalian mammalian unknown unknown 13 Alu | |||
| Features of the rat prion gene | ||||||||||
dir - + - + - + + + | start 445 742 1136 1275 2174 3864 4302 2943 | stop 477 881 1268 1342 2266 4069 4428 3059 | bp 33 140 133 68 93 206 127 117 | gap 265 255 7 832 1598 233 - - | feature RSINE2 RSINE2 B1 RMER17A RDRE1_RN B3 B1 B3 | sorted B1 B1 B3 B3 RDRE1_RN RMER17A RSINE2 RSINE2 | lineage rodent rodent rodent rodent rodent rodent rodent rodent | |||
| Features of the mouse prion gene | ||||||||||
dir - + + + - - - + - + - + + + + + + + - + + + - - + + + + + + + + + - + + - + + + + + + - + + + - - - + + | start 1400 2225 2314 3695 4189 4643 4796 5296 7314 7649 7980 8110 9619 10044 11233 12198 12675 13008 13607 13755 14007 15035 16219 16687 17440 18222 18806 21141 22643 22680 22720 22812 22854 22898 23280 24946 25807 26201 26470 26990 30947 31289 31438 32607 33417 36189 36370 36455 36719 36943 37166 37591 | stop 1478 2283 2608 4116 4342 4738 4929 5521 7348 7758 8095 8169 9844 10163 11296 12243 12747 13214 13739 13793 14061 15534 16589 17068 17992 18772 20986 22619 22679 22717 22811 22853 22897 23279 23384 24994 25889 26397 26534 27159 31131 31398 31555 32873 33570 36323 36420 36588 36908 37139 37217 37790 | bp 79 59 295 422 154 96 134 226 35 110 116 60 226 120 64 46 73 207 133 39 55 500 371 382 553 551 2181 1479 37 38 92 42 44 382 105 49 83 197 65 170 185 110 118 267 154 135 51 134 190 197 52 200 | gap 747 31 1087 73 301 58 367 1793 301 222 15 1450 200 1070 902 432 261 393 16 214 974 685 98 372 230 34 155 24 1 3 1 1 1 1 1562 813 312 73 456 3788 158 40 1052 544 2619 47 35 131 35 27 374 - | feature BGLII ORR1B ORR1B MER67C RSINE2 ORR1B ORR1B B3 RSINE2 RSINE2A B1 RMER17A B3 B1 L1MD2 RSINE2 MUSID4 B2 B1 RMER1B MUSID5 L1MA2 ORR1D RLTR1IAP_MM IAPEYI IAPEYI IAPEYI IAPEYI IAPA_MM IAPEYI IAPA_MM IAPEYI IAPA_MM RLTR1IAP_MM B1 MUSID6 LTR10A LINE2 MUSID4 L1_MM B3 B1 B1 RSINE2A MER5A B1 B1 B1 MLT2B2 MLT2B2 RSINE2 MLT1B | sorted B1 B1 B1 B1 B1 B1 B1 B1 B1 B2 B3 B3 B3 BGLII IAPA_MM IAPA_MM IAPA_MM IAPEYI IAPEYI IAPEYI IAPEYI IAPEYI IAPEYI L1MA2 L1MD2 L1_MM LINE2 LTR10A MER5A MER67C MLT1B MLT2B2 MLT2B2 MUSID4 MUSID4 MUSID5 MUSID6 ORR1B ORR1B ORR1B ORR1B ORR1D RLTR1IAP_MM RLTR1IAP_MM RMER17A RMER1B RSINE2 RSINE2 RSINE2 RSINE2 RSINE2A RSINE2A | lineage rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent rodent | |||
| Features of the sheep prion gene | ||||||||||
dir - + + - - - + - - + + - - + + - + - + + + - - + - + - + + - + + + + + + | start 1 321 1038 2092 2194 2503 2684 3760 4132 11940 16433 16566 17747 18422 18758 18975 19211 19376 19782 19843 21580 23801 24708 27249 27347 27568 27721 27816 27932 28140 28343 28602 29349 30417 30807 31287 | stop 316 539 1159 2192 2492 2553 2842 3958 4215 12038 16524 16654 18115 18709 18929 19181 19368 19781 19839 19866 21689 24187 24872 27346 27563 27711 27815 27906 28134 28336 28591 28652 29733 30545 30950 31412 | bp 316 219 122 101 299 51 159 199 84 99 92 89 369 288 172 207 158 406 58 24 110 387 165 98 217 144 95 91 203 197 249 51 385 129 144 126 | gap 5 499 933 2 11 131 918 174 7725 4395 42 1093 307 49 46 30 8 1 4 1714 2112 521 2377 1 5 10 1 26 6 7 11 697 684 262 337 - | feature BOV2 MER21B BOVA2 MER5A BOV2 MER5A BOVTA MLT1F MLT1F ALTR2 BOVTA BOVTA BOV2 BTALUL1 L1A_OC BOVTA L1A_OC BTALUL2 BDDF2 L1A_OC MIR2 BOV2 BOVTA ARMER1 NLA ARMER1 LINE_CH L1MA5 L1S2_SS BTALUL1 L1S2_SS L1MA9 L1A_OC MER5A MER5A BOVTA | sorted ALTR2 ARMER1 ARMER1 BDDF2 BOV2 BOV2 BOV2 BOV2 BOVA2 BOVTA BOVTA BOVTA BOVTA BOVTA BOVTA BTALUL1 BTALUL1 BTALUL2 L1A_OC L1A_OC L1A_OC L1A_OC L1MA5 L1MA9 L1S2_SS L1S2_SS LINE_CH MER21B MER5A MER5A MER5A MER5A MIR2 MLT1F MLT1F NLA | lineage bovidae bovidae bovidae bovidae bovidae bovidae bovidae bovidae bovidae bovidae bovidae bovidae bovidae bovidae bovidae bovidae bovidae bovidae bovidae bovidae bovidae bovidae bovidae bovidae bovidae bovidae bovidae bovidae bovidae bovidae bovidae bovidae bovidae bovidae bovidae bovidae | |||
| Features of the cattle prion gene | ||||||||||
dir - - + | start 1717 2633 1830 | stop 2093 2797 1878 | bp 377 165 49 | gap | feature BOV2 BOVTA C_OC | sorted BOV2 BOVTA C_OC | lineage bovidae bovidae bovidae | |||
27 May 99 webmasterThe rat prion gene was sequenced by Saeki et al in 1994. The sequence of 8,494 bp region SEG_D50092S begins 2,831 bp upstream of exon 1 and ends 1,687 bp downstream of the coding region. The long intron 2 was only partially sequenced: 197 bp down from the 5' end and 628 bp up from the 3' end. The GenBank entry contains no feature analysis other than exon boundaries and poly A sites, though three associated articles make an excellent analysis of transcriptional regulation.
Subsequently, IY Lee et al. briefly noted a processed cytochrome c pseudogene in rat prion just upstream of exon 1 that presumbably delimits the promoter region in all mammals. As a comparable pseudogene is missing in mouse and no outsplicing mechanism is available, the insertion in rat occured after the two species diverged.
A great deal is known about cytochrome c pseudogenes in rodents and primate [due to R. Scarpulla]. Rats have a cytochrome c multigene family of approximately 30 processed pseudogenes representing three alternatative cytochrome c mRNAs of sizes 1400, 1100 and 700 (length heterogeneity is in their 3' noncoding regions). One pseudogene class has a complete 3' noncoding region including a short poly A tail but is abruptly truncated at its 5' end, 19 amino acid codons up from the translation terminator, where it is fused through 17 consecutive A's to a 1.3 kb truncated long interspersed repeat sequence flanked by direct repeats.
There is a single functional copy of somatic rat cytochrome c containing a 105-base pair intron interrupting glycine codon 56; none of the pseudogenes contains this or an upstream intron, hence they are processed (reverse-transcribed from mature mRNA) with short direct flanking repeats and non-functional because of internal stop codons. This applies to the rat prion pseudogene.
Rats and mice additionally have an older single-copy paralogous cytochrome c with no detectable pseudogenes expressed during spermatogenic differentiation. The rat testis gene is 7 kb with three introns of 6.5 kb differing in position and size from the two introns of the 2.1-kb somatic gene of 0.9 kb. Humans have a single copy somatic cytochrome c gene nearly identical in both size and intron/exon structure to rodent somatic genes. The 11 known human processed pseudogenes are of two very distinct age classes, early and late. Some human cytochrome c pseudogenes have evolved at an exceptionally low rate. Human prion does not contain a cytochrome c pseudogene.
Despite the equimolar ratio of the three mRNA in rat tissues, nearly all of the 30 pseudogenes are derived from the 1,100-nucleotide mRNA. The rat prion pseudogene belongs to this commonest class. It is not identical to any of the previously sequenced rat pseudogenes but might be one of the 30 identified by hybridization. The rat testis cytochrome c gene can be eliminated as parent of the prion pseudogene by ClustalW alignment.
An odd feature of rat prion, not noted earlier, is the presence of a 111 bp disruption of the cytochrome c pseudogene at position 2174-2266. Jerzy Jurka has identified this as a 99 bp + RDRE1_RN plus flanking regions, a very common repeat element in the rat genome. The site of insertion bears no relation to the site of out-splicing of the cytochrome c intron. The obvious sequence of events is mouse-rat divergence, followed by pseudogene insertion in prion gene, then RDRE1_RN insertion within the inserted pseudogene, ie, the repeat element insertion is the most recent event.
The other four retrotransposon elements upstream of rat exon 1 cannot be dated by this method and pre-date the mouse-rat divergence since they are present in both lineages. Hamster sequence does not extend far enough and comparable regions are missing from other mammals.
Hamster prion would be a very instructive sequence. Unfortunately, the best sequence in this region, M14055 , does not extend up to the pseudogene or repeat insertion regions. In using Blast on a pair of sequences of this type, it is vital to lower gap penalties, say 2 for opening and 1 for extending. Gaps are just as common as point mutations in non-coding sequences and so should be weighted similarly. (The NCBI Blast service supports custom gaps as an advanced option: paste in "-G 2 -E 1" and shut off filtering) The hamster sequence gave 310/470 (65%) identities using generous gaps; using default parameters, two strongly conserved regions exhibit 153/181 (84%) and 31/35 (88%) levels of conservation.
promoter region rat 33 bp +RSINE2 445- 477 mouse 35 bp +RSINE2 7314-7348 rat 140 bp -RSINE2 742- 881 mouse 110 bp -RSINE2A 7649-7758 rat 133 bp +B1 1136-1268 mouse 116 bp +B1 MM 7980-8095 rat 67 bp -RMER17A 1275-1342 mouse 60 bp -RMER17A 8110-8169 rat 99 bp +RDRE1_RN 2174-2266 mouse ---- ---- ---- intron 1 rat 206 bp -B3 3864-4069 mouse 226 bp -B3 9619-9844 rat 127 bp -B1 4302-4428 mouse 120 bp -B1F 10044-10163 post 3' UTR rat 117 bp -B3 [2943-3059]* mouse 185 bp -B3 30947-31131 or -B3 9619-9844 or 1 -B3 5296-552 *numbering of rat switches from D50092 to D50093 fragment; the rat polyA site is at 2625Masking the repeat element RDRE1_RN improves alignment of pseudogene and parent cytochrome c gene K00750. Overall, 848/917 identity (92%) is found with minimal gapping. However, 38 bp of exon 1 5' UTR are missing from the pseudogene; this bears however no relation to out-splicing site of intron 1 of cytochrome c.
Masking both the pseudogene and its insertion also improves alignment with mouse. The other 4 retrotransposons and the motif regulatory region serve as reliable flanking anchors for this alignment. However, these repeats are rodent lineage only and are lacking from human and sheep so should be masked prior to alignment there. An portion of the rat gene upstream of exon 1 annotated for all the features mentioned is shown below:
One measure of this pseudogene's history is the accummulation of stop codons (2), frame shifts (0), point mutations (11), deletions (3bp x1), and insertions (3 bp x1) relative to the 105 residues of functional cytochrome c. Note rat and mouse functional proteins are identical, so the pseudogene unsurprisingly is evolving much faster. The insertion event in the prion gene thus might be dated by these events to roughly ten million years ago.The pseudogene could never have been functional because a very old B1 repeat element occupied the place of a promoter. Thus, the functional rat prion promoter -- and by homology, the mammalian promoter --must reside in the first 452 bases upstream of exon 1 because 1,245 extraneous bases precede this.
28 May 99 webmasterTo determine those sequences upstream of exon 1 important to prion gene regulation, researchers commonly align various species and take conservative stretches as important. The difficulty here is that introns and promoters require much more extensive gapping than coding sequences because frame shifts are not a significant issue. As gap opening and gap extension software parameters are arbitrary (or pertain only to coding sequences), this leads to loss in confidence in alignments.
Outgroup arbitration is a topologically driven consensus technique proposed here to sharpen these alignments. It requires sequences from 3 or more species clamped to a definitely known topology of divergence. In the case of the prion promoter (hamster, (mouse, rat)) or (rat, (mouse1, mouse2)) are the known trees. The geometry of the tree is most favorable if branch lengths are approximately equal. For example, had (mouse, rat) divergence been too recent relative to the rate of mutation, few opportunities to apply the technique would exist; if the divergence had been too early, the tree becomes a trichotomy and alleles may drift differently than speciation.
Outgroup arbitration works because two rare events are far less likely than one rare event -- a small number squared vs a small number. The method is much stronger than simple consensus but does require knowing the topology of the relevent tree. When the context allows for slippage of tandem repeats, confidence is down-weighted as these are evidently rather common.
The tree below illustrates the case analysis. The outgroup can resolve feature ambiguity in the ingroup when it can cast a deciding vote. In nested outgroup arbitration, the restored sequence can then serve as a noise-filtered outgroup to, say, (cow, sheep) as the process is repeated. The table below lists all combinations of scenarios (either gaps or point mutations; may include sequencing errors). Outgroup arbitration is only applicable to half of these cases. The others must be deferred to a more distant outgroup.
| Sequence Feature Analysis by Outgroup Arbitration | ||||
| Distribution of Feature | Allocating events to rodent tree | |||
| hamster | mouse | rat | Interpretation |  |
| + | + | + | none | |
| + | + | - | rat deletion | |
| + | _ | + | mouse deletion | |
| - | + | + | deferred | |
| - | - | - | none | |
| - | - | + | rat insertion | |
| - | + | - | mouse insertion | |
| + | - | - | deferred | |
The prion promoter sequence upstream of exon 1 is surely bounded by the 1254 extraneous bases inserted in the rat prion. This leaves 454 bp between exon 1 and the cytochrome c pseudogene to analyze. That same region has been sequenced (several times) in mouse and no additional insert sequences occur. Regretably, hamster sequence M14055 stops short with 339 bp. This limits the opportunity (by 115 bp) to fully define conserved areas within the rodent prion promoter.
Nested outgroup arbitration is surprisingly effective when applied to (hamster, ((mouse1, mouse2), rat)) as seen below. Some 39 point mutations can be resolved. An unsuspected 22 bp insertion of high G content is found in rat prion promoter at site 290 that is missing in hamster and mouse: it is unlikely that hamster and mouse had separate deletions at the same site. Topology rules: had the extra bases been found in hamster, nothing could have been inferred. Mouse has a 16 base insertion with high C content beginning at 365 lacking in rat and hamster. At 394, a 10 bp deletion is seen in rat. The figure shows how several of the 40 point mutations resolved. Many point events and gaps do not qualify under the rules of arbitration; their resolution is deferred.
.
D50092 rat 2380-2831 -- M14055 hamster 1-411
U29186 mouse1 8193-8573 --
U52821 mouse2 757-1138 --
Y17510 mouse3 4-310 --
X79932 mouse4 10-273
The prion promoter is somewhat mysterious in that even with filtering of insertion elements and a strong reconstruction procedure to suppress noise, the rodent sequence still aligns poorly in places with other mammalian prion promoters. (This was noted earlier by IY Lee.) The reference sequence above as query only calls forth a 185 bp stretch below of human prion U29185 with Blastn (set generously). There are no interfering insertions in human prion in this vicinity. Bovine and sheep prion promoters are also brought out by this particular stretch. These sequences are well-anchored in the so-called motif region.
The best rodent promoter region that emerges from this process (delimited 5' by cytochrome c pseudogene and 3' by exon 1, lower case bases inferred, best human homology zone in blue:
>rodent reference promoter by outgroup arbitration; 516 bp agaAggGGAAAAGAAGGAATCAGCAGAGAATAAATAAGTCAACATGCAATGGCCAAtATACTTTCTAGGCCTCTAATTCTTTTATAGTTT GTGGGAAAATGTCgAAAATCTTCctctTTACCAATTTCTTGTTACCAAAGTTtCaACGATGGCTTtcTCgcTCCGTTAGGTAACCTTTCA TTTTCTCaACTaCCCcATTATGTAACGGGAGCatTGGGTtCTGGATCAGTCTTCCATTAAAGATGAtTTTTATAGTcggTGAGCGtCGTC AgGGAGTGcTGACACTGGGGGcGGtTTAAACAGATACAAGCATTTAAGCCAGTcCGGAGCGGTGACTCATTCCCcCCGCGAGAgACGCGG CGCGGCCATTGGTGAGCACgacgCAaGCcCCGCCCCACccaGCCCGGCCcCGCcCTgCtaCCtgtCctGcCcCtctcCCCcgCCcGCTCC CCCGCGttGTCgGAgCAGCAGACcGAgaaggcactTCgaggCgcttcgTCGCgTCGGTGGCAGGT
>rodent intron 1: the 3' end + exon 2 by outgroup arbitration; 40 improvements, 185 bp gaacgtgccatgtttgcttttgggaatctatctgagctgttcttatttccAtTTtcaaatactgccccatttttATgTgCCtgtAtttaG TaGtggTttgAtAatttgTatattagatGGtAtttcagttctcagacttattcatcaattctagtttttctttttgttgttttaaaggac tcctgaAtatattccaAaactgaaccatttcaaccGaGctgaagTattctgTTTttctagaggtaccagtccAGtttaggagagccacag cagatc
webmaster 30 May 99The fortuitous occurence of a pseudgene in rat prion suggests that all active regulatory and transcription initiation control regions will be found downstream of the insertion site, in all mammals by homology.
rat 170 + motif 1 + 318 gaaaggaaagaagggaatcaa ccgagaatgataaaccaacattcaatggccaatatactttctaagcctctaattctttta tagtttatggggaaatgtcaaaaatcttcctctttaccaatttcttgttaccaaagttcc acgatggctttttctttccgttaggtaacCTTTCATTTTCTCgactacccattatgtaac gggagcgctgggttctggatcagtcttccattaaagatgacttttatagtctgtgagcgt cgtcacagagtgctgacactggggtggggaggggagtacggggggagggggttaaacaga taacaagcatttaagccagtacggagcggtgactcatcccaccgcgagaagccattggtg agcatcacgctccgcccctcgccccgcccagcccccggcctgtcgggtccctcaccacgc cccgctcccccgcgttgtcagagcagcagacggagtctgagcgtcgcgtcggtggcaggt mouse 231 + motif 1 + 322 ctatggga ttgtctccaaagataaagaaaaaagggaaggagagaaaagaaaaagaaaggaaagaaggg gaaaagaaggaatcagcagagaataaataagtcaacatgcaatggccaatatactttcta ggcctctaattcttttatagtttgtgggaaaatgtcgaaaatcttcgttaccaatttctt gttaccaaagttcaacgatggcttcctcgctccgttaggtaacCTTTCATTTTCTCaact acccattatgtaacgggagcattgggtactggatcagtcttccattaaagatgattttta tagttgctgagcgtcgtcagggagtgctgacactgggggcggtttaaacagatacaagca tttaagccagtccggagcggtgactcattcccccaccccccacccccccgcgagagacgc ggcgcggccattggtgagcatcacgccccgcccctcgcccagcctagctcccgcctgccc cgcccctttccactcccggctcccccgcgttgtcggatcagcagaccgattctgggcgct gcgtcgcatcggtggcag hamster 73 + motif 1 + 324 tcgaaaatctccctctttagcaatttcttgctcctagagtttcagcaattgctttctcgc tccattaggcaacCTTTCATTTTCTCaccttccccattatgtaacgggagcaatgggttc tggaccagtcttccattaaagatgatttttatagtcggtgagcgccgtcagggagtgatg acacctgggggcggtttaaaccgtacaatcccttaaaccagtctggagcggtgactcatt tccccagggagaagtggcgcggccattggtgagcacgacgcaagccccgccccacccagc ccggccccgccctgctacccctcctgactcactgccccgcccgctcccccgcggcgtccg agcagcagaccgagaaggcacatcgagtccactcgtcgcgtcggtggcag human 223 + motif 1 + 411 start 12121 taatatcaccacctaaatcatctcttgcctaaaacaaggagtagaaagtgaatgaaggaa ggaacaggtgatggtcagtgtcctttctacgcctcaaaatttaagagtttatgtgaaaat tcataaatattaatctcaatccaggttaagcaaaattttttgctctcctctttagaaatt tctggttgccaaagttccagaaattgcttcctcattcctgagcCTTTCATTTTCTCgatt tctccattatgtaacggggagctggagctttgggccgaatttccaattaaagatgatttt tacagtcaatgagccacgtcagggagcgatggcacccgcaggcggtatcaactgatgcaa gtgttcaagcgaatctcaactcgttttttccggtgactcattcccggccctgcttggcag cgctgcaccctttaacttaaacctcggccggccgcccgccgggggcacagagtgtgcgcc gggccgcgcggcaattggtccccgcgccgacctccgcccgcgagcgccgccgcttccctt ccccgccccgcgtccctccccctcggccccgcgcgtcgcctgtcctccgagccagtcgct gacagccgcggcgccgcgagcttctcctctcctcacgaccgaggcag sheep 278 + motif 1 + 324 gttttatacaagaaatctcaggtaatgtgcagaatggacttgttaaatggagtgcatttc cctcacttatgaatatcataatctaaatcatttactttgtaaataatgagcaggaactga gtaaatgacggcaggtgatggctaatatcctttctaggcctcaaattttaatctgaaaat tcacaaacattgggcttaatccagggtagtagaatttttgtccttttcagaaatttctgg ttaccagagttcccgaaattgctttctcattccctaatCTTTCATTTTCTCcattacgta acgagaagctggggctttggccgattttccctctaaagatgatttttatcgtcaacaagc aatttcagggagtgatgagccagggaggcggtgttagttgatgctagcgtttatgctagt ctcaactcgtttttcccagggacttagattcctgggtctgccggtaaaccccgggcgccc gcagcgggcgcgcctgagcgtgcgcgcgccgtcgcctccccccccccgcagctcctcctc tgcacggcgactcaccagccctagttgccagtcgctgacagccgcagagctgagagcgtc ttctctcccagaggcag cattle 513 + motif 1 + 328 start 1 aagcttagtggagcctcttgcccataacaaggggactagatatttcatttttcccaggtt tatatccatttccctggcataattaatattggtactctcaaaagtgcccaaatttgggta atgatatatatgatccctctaaccctaacacatgtcttctatcacttgccatccttcaca tgagacaaacccctacataaaattttggcagtaataatgatcaagtacacaccatgtttt atacaagaaacctcaggtaatgtgctgaatggacttgttaaatggagtgcatttccctca cttatgaatatcataatctaaatcatttattttgtagataatgagcaggaactgagtaaa tgacggcaggtgatggctaatatactttctaggcctcaaattttaatctgaaaattcaca aacattgggctcaatccagggcaatagaatttttgtcccttttagaaatttctggttacc aaagttccagaaattgctttctcattccctaatCTTTCATTTTCTCcattacgtaacgag aagctggggctttggccgattttccctttaaagatgatttttatcgtcaacaagcaattt cagggagtgatgagccggggaggcggtattagctgatgctagcgtttaagctagtctcaa ctcgtttttcccagggacttagattcctgggtctgccagtaaaccccgggcgccggcagc gggtgcgcctgagcgtcgcgcgcgccgtcgcctccccgcccctgcccctcctcctccgcc cggcgacttacccgccctagttgccagtcgctgacagccgcagagctgagagcgtcttct ctctcgcagaagcag
29 Mar 99 webmaster
Intron I has been sequenced from 5 species and the intervening retrotransposons determined by several methods. The length averages 2,401 bp with 221 bp of intervening sequencing, leaving 2,180 as the reconstructed ancestral length. However, after discounting retrotransposons, non-rodents average 2,386 bp while rodents average 1,871 for a 515 bp difference. Proposed retrotransposon events include two in the ancestor of mouse-rat, three in humans, four in cattle, and three in sheep and are shown in the table below.
Somewhat confusingly, an L1M-MIR -L1M within intron 1 is suggested in human and sheep by Lee (in Figure 2) but is not in their GenBank entry; only human is confirmed by Jurka (more precisely as L1MD2, MIR, L1ME3A ). We shall see shortly that human aligns strongly with sheep in this region, validating Lee on sheep. Cattle is strongly homologous to sheep along all of intron 1 and so deserves a similar annotation. Rodents present a complication in that more recent disruptive rodent-specific B1 and B3 elements must be removed before any comparisons can be made.
Jurka identified a 49 bp element C_OC in cattle but not in sheep. However, the alignment is excellent other than for one puzzling stretch, T's in cattle, C's in sheep. This is treated as a homologous 45 bp C_OC element in sheep here. Human, rat, and mouse lack signficant alignment here.
ttttttgctgtcctttttcgtttttgttttttttttttccttttcttt C_OC cattle element 1830-1878 ttttttgctgttctttttcgttttttcccccctct----cttttcttt C_OC sheep element 6682-6726
Intron 1 has been rather conserved in length (9% increase) over the last 100 million years of evolutionary time, in marked contrast to intron 2 which has grown by 40% in size. Notice however that the rodents are discordant with the other mammals averaging 1,871 bp vs 2,386 bp. This suggests either a 515 bp deletion in the rodent lineage (or numerous smaller deletions summing to this) at the upstream end of intron 1 or an unidentified 515 bp insertional element in other mammals.
| Intron 1 | |||||
|---|---|---|---|---|---|
| species | length | start | stop | inserts | net |
| bovine | 2442 | 856 | 3297 | 49: -C_OC 1830-1878 | 2393 |
| sheep | 2423 | 5718 | 8140 | 45: -C_OC 6682-6726 | 2423 |
| human | 2720 | 12768 | 15487 | 378: +L1MD2 14413-14514, +MIR 14583-14657, +L1ME3A 14752-14952 | 2342 |
| rat | 2230 | 2879 | 5108 | 333: -B3 3864-4069 , -B1 4302-4428 | 1897 |
| mouse | 2190 | 8659 | 10848 | 346: -B3 9619-9844 , -B1F 10044-10163 | 1844 |
| average | 2401 | - | - | 221 | 2180 |
>intron 1 bovine 856..3297 D26150
gtaaa tagccgcgta gtcctttaaa ctcccagcgg aggacgccaa
901 ccctgggtct tgcggccgag gcccagggac ccagccgaat cggattggtg ggaggcagac
961 cttgaccgtg agtagggctg ggggcttgcg gcgggcgcgg ggaacgtcgg gcctgttgag
1021 cgtgctcgtt ggtttttgcc agccgccgct cggttttacc ctcctggtta ggagagctcc
1081 atttactcgg aatgtgggcg ggggccgcgg ctggctggtc cccctcccga ggtatgtggg
1141 tggtgtgtag gaatctagcc ccctcccacg ctcgtccact gcgggagtgg gatgggcgaa
1201 tcgcaccggt agaggggccg cagtcgagga accgctgggg acctcagaag aacaagggcg
1261 agcccgggat ttgggccctc ccgaagccca gaggagtcgc ggaattgggg gtgggggtgg
1321 tggggaagaa acgggcgcca acggggcccg acctcggcgg tgaggagtgc cggagcatcc
1381 gtgggccccc agccgctgct gccgaactcc tcccgagagg cggccctgcc tgccatcacg
1441 cggctgggag gtacctgggt agccgcagcg ggtgggtctc tggcaacccc ccggggatcg
1501 gctctggcgg gcgtacgtgg cctgggcttc agcctcggcg cggggaatca tgggccacct
1561 ggcgctctct ccgggccaga gaaatccagg taccgggaac agtgtttcct gggagctctg
1621 atgtggtgga cccaaaagca aagcgaaatt ttccctgtct cgactgatcc tccagaagga
1681 gggaactcgg ccgtcaggag actgagggga ggggattcag gcgcctctca gagaaccacc
1741 ctcatctgcc agtaagggtg gcaccttcac gcttgatttt tttttttttt tcccctcaca
1801 cgtttgatta ttaaacaacg agaagtccgt tttttgctgt cctttttcgt ttttgttttt
1861 tttttttcct tttcttttgg taccatatgt agcaaataga ttttttaaaa tcataagccc
1921 accaccctca ccatcttttt ttcagtttcc tcgtctccag attcttaaca acaaagcagt
1981 ttcacctccc tgatcatggt tatccttatc tcatggccgg gttattttct tgtacttaag
2041 agcaatcacg ttttattaag cagttccccg aatgctgaac ctttgaagtg ttacctttcc
2101 ttacaaaaga taccacatag aataggatta aaaattttca caagttgtca gagaaaaata
2161 ggaacagaaa attgtataaa aatgtcagac ctctggaaaa tgaacagctc tctcagattt
2221 gaaaattaac ctatgaaaag gaacagtttt cctacggaaa cattgaggtg ctctaacaat
2281 gaaaaagaat cagaaaagga aaaaaacaga gttaggatgt gatttgtata tgatttgtat
2341 ctgatgcaaa tttttcatac ttgtgaaaga aaaatatcaa gattataaaa agataaatgg
2401 tgaaatgaac aatcatttat gaaataaaat acaaatcaaa gcaagtctgg atttacaact
2461 actagtaaaa acaacagtaa cagcaaccac ttctggaaag ttacctagaa atttgcatat
2521 tcagtatgtg aggtggcaag gctttggagt tagaaatatg gtctgcaact aattttacaa
2581 tttgggacct aatttcctca tccccctttt ggacattcat aaaatagagg aaattatacc
2641 tacttcagag tttgccaaga ttaactgtgt aaaactgacc tttagtgtgt atacttttat
2701 tcttttccta gtcacactgc actgggggac gttgtgaatc tgtatgaaat ttgtgaaaaa
2761 cagtcaggtg atcctttaag ccatgaccct aaaacccact cctgggaact tacctgtaat
2821 ggaggaaacc aggaaagaag aagaaaagct gcattcaccc acagaactca gaatgatcta
2881 aaattagatc cagtccggag tcaacctaaa tgtattaata aaatagcagg gcagcagcta
2941 agaaaatcat agcactttaa ctgaaaggaa cattgtgtaa ccatcacgag tcataatttt
3001 agagcctctc tgtgatatac aggaaaaaac tgacaggtca aagtaagatt actcagacat
3061 ggatgcgttt gtggaaaatc tgaatgaaaa atgaatccac agtttgctgt gtatgggagg
3121 agagttcagt gtcacgtttg ctgctttttt taagttagca tcatctcttt tttaaaaata
3181 ctatcatatt ttttccctga gtagattcat tagtggttta ataatttata tactgttatt
3241 ctgttaaata atccgttctt agatttatca attatagttt tttctttttt ttttaag
>sheep intron 1 U67922 5718-8140
gta aatagccacg tagtccttta aacccccagc ggaggccgcc
5761 cccggcttgc ggccgaggcc ctagggcact cagccggatc ggactggctg ggaggcagac
5821 cttgaccgtg aggaggactg ggggcttccg gcgggcgcgg ggaacgtcgg gcctgtttag
5881 cgtgctcgtt ggtttttgcc agccaccgct cggttttgcc ctcctggtta ggagagctcc
5941 atttactcgg aatgtgggcg ggggccgcgg ctggctggtc cccctcctga agtatgtggg
6001 tggtgtgtag gaatctagcc ccctcccacg ctcgtccact gcgggagtgg catgggcgga
6061 tcgcaccggt agaggggccg cagtccgagg aaccgctggg gagatcagaa gaacaagcga
6121 gaggccccgg gctctgggcc ctcccgaagc ccagcggaga cgcggaattg ggggtggggg
6181 gtggggaaga agcgggcgcc caacggggcc agacctcggc cgtgaggagt gccggagcga
6241 ccgtgggccc ccagccgctg ctgccgaact cctcccgaga ggcggccctg cttgccatca
6301 cgcggctggg aggtacctgg gtagccgcag cgggtgggtc tctggcagcc ccctggggat
6361 cggctcgggc gggcgtgcgt ggcctgggct tcagcctcgg cgaggggagt catgggcgac
6421 ccggccctct ctccagagaa atccaggtac cgggagcagt gtttcctggg agctctgatg
6481 tggtcgaccc aaaagcaaag cgatattttc gctgtctcga ctgaaggagg gaactcggcc
6541 ctcaggagac tgaggggagg ggatcaggcg cctcttggag aaccaccctc atctgccagt
6601 aagggtggca ccttcacgtt tttttttttg ttgttgttgt tttctcacac gtttgattat
6661 taaacaacga ggagaagtcc gttttttgct gttctttttc gttttttccc ccctctcttt
6721 tcttttggta ccatatgtag caaatagatt ttttaaaatc ataagaccac catcctcacc
6781 atcttgtttt tcagtttcct cgtctccaga ttcttaacaa agcagtttca cttccctgat
6841 gatggttatc ctcatctcat ggccaggtta ttttcttgta cttaagagca atcactgttt
6901 attaagcagt ttcccgaatg ctgaaccttt gaagtgttac ctttccttgc aaaagattcc
6961 gtatagaata ggattaaaaa ttttcacaag ttgtcagaga aaaataagaa cagaaaattg
7021 aataaaatgt cagacctctg gaaaatgaac agctttctca aatttgaaaa ttaactataa
7081 aaaggaacag ttttcctacg gagacactga ggcgctctca gtgaaaaaga acgatgaaaa
7141 agaaccagaa aaggaaagaa aacggagtta tgtatatgat ttgtatctga tgcaaatttt
7201 tcatacttgt gaaagaaaaa tatcaagatt ataaaaagat aaatggtgaa atgaagaatc
7261 atttatggaa taaaatacaa atcaaagcaa gtctggatta tcgttttaca actactagta
7321 aaaacagtaa cagcaaccac tcctggaagg ttacctagaa atttgcatat tcgtttatgt
7381 gaggtggcaa ggctttggag ttagaaatat ggctctgcag ctaattttac aatttgggac
7441 ctaatttcgt catcgtcctt ttgtccattt ataaaataga ggaaattata cctacttcag
7501 gagtttgcca agattaactg tgtaaaactg acctttagca tgtatacatt tattctttcc
7561 ctagtcacac tgcactgggg gacatttgtg aatctatgaa atttgtgaaa aatggatcct
7621 ttaagccatg accctgaaac cccactcctg ggaacttacc tgcaatggaa gaaattcgga
7681 aagaagaaaa gctgcattca cccacagggc tcagaatgat ctaaaattag atccagtcca
7741 gagacaacct aaaggtatta agaaaatagc agggcagcag ctaagaaaat catagcactt
7801 taactgaaag gaacattgtg taacccatca cgtggcataa ttttagagcc tctctgtgat
7861 atataggaaa aaagtgacag gtcaaagtaa gattactcag acatggatgc atatgtggaa
7921 aatctgaata aaaaatggac ccacagtttt ctgtgtatgg gaggagagtt cagtgtcatg
7981 tttgctgctt ttttttagtc agcgtcatct cttttaaaaa tactatcata tttttttcct
8041 tgagtagatt cattagtggt ttaataattt atatactgtt attctattaa ataatccgtt
8101 cttagattta tcaattatag tttgtttttt tttttaagga
>human intron 1 U29185 12678-15389
ccc cctcggcccc gcgcgtcgcc tgtcctccga gccagtcgct
12721 gacagccgcg gcgccgcgag cttctcctct cctcacgacc gaggcaggta aacgcccggg
12781 gtgggaggaa cgcgggcggg ggcaggggag ccgcgggggc cgagtgagga ccccgggcct
12841 cgggtcccag gcgcaagggt gcccggccgg gcggggtcgg gaccccagtg aggaggggcc
12901 gggggctgcc ccgcgggcgc gtgacggtct cgggcctgcc cggctgcgct ggtctccgct
12961 cgggtgaggc ggcttggctt cgcttttcag gttaggaaag ctccctttac tgcgcgttgg
13021 ggggctgggg gagctggcgg agccacgtta gggaggtcgg tggcgccggg gtgtctcagc
13081 gccccctgca ccccgcgcgg gtccggccca gcgggcgatc gctggcgccc agggaactcc
13141 gggagggccg ccagcgggct ccgcaggcgc ggggcgggga ggggcgcctg ggggccgcgg
13201 ggctcgcgct ccccgcccgt tggccgcccc tcggaggccg agatcggggc ccagaacgcc
13261 ccttggcaaa gcctggcgct tccgcgatgc ccagagggtg cttgggggga tggagagagg
13321 ggcgcccgcc ggggtagttc cgggagcctc ggtgcctccc gccgcagctg cagcgttcct
13381 cccgggaggc ggcccagccc ttcatcctcg ccgcctgagc ttctccgagg ggggctgcag
13441 ccttgcggcc gttgccaccg cctggagaag cggcccacgc ggactgacgg gcgggggcgg
13501 ggcctcgggc ctcggcgggg gcggggtccg gggaggcccc accctctgtt ctccaggggc
13561 ggggagagag gagctgcagg tctgcggcct ggccccaggt gcgatggcgg accccagctt
13621 ggccagtcac attcctccca gtccccctgg agggagaacg ctggccatgg ggggctccaa
13681 ggaacaacca gcctcggatg acgacccttg ggtcaccggt ctccccacct gtgcggcagg
13741 cgccttcacg tttcattatt aaacaatggg gagaaatcca tgtttactgt cctttttagg
13801 aattttttgc tcttctcttt gaggtggctg taggaaatag attttttttt taacctcgca
13861 attccaccac ggtcacatcc atcctcgcca tcgcagagcc acagctctcc gtttttgttt
13921 cctagcctcc agattctcac acaacacagt gcagtttcac tgctgtaatg atgaggatct
13981 tcatggccgc gttattttct tgttctgaga gcatcacggt ttaattagca gttccccata
14041 tgatttgaag tgtttcccgt ttccttaggg aaaactcctg gtagaatagg attaaggatt
14101 tttacaaata taattatcaa aaacatagga acagggaatt ggataaatat gttaaacttc
14161 tggaaaaatc aacaacgctc ttagatttgt agaagaaagg aaaaaatcac cagtggaaag
14221 gagcaatttt acttacacaa acacagagaa ggtcttacag tgaaaaaaag ctaaccagta
14281 aggggaaaag caggcagagg ggtaggatgt gatttgtatg ttatttatat ctaacacaag
14341 tcttccacac cgaaaggaaa atattaagat tataatagat aaatggcaaa atgatgagtc
14401 atttacacaa taaaatgcaa attagagcat gtttgggtta tcattttaca tctattaaaa
14461 taaccaaaat aattaatagt aacagcaacc cttgctggaa ggttgcccaa aacttggcat
14521 tttcaagtgt ctggggaggt ggcagggctt tggggtcaca aagatggttc tgcagtcaat
14581 tttgtgacct tggacaggct acctaatttc ctgatcctcc ttttgtccat tcatagaatg
14641 gaggaaatga tagctacttt ctgcgtctgt atgtatgagt tattgggggc atttcgaacc
14701 agtgacaaac attttgttaa gcaatctggt gatgcattaa gaagctggaa gctgtgaccc
14761 agaaacccca ctcctgagaa cttacctgca atggaagaaa caaacaaaca aaaacaggca
14821 tgtattccta gcagaatgat ctaaaattag aacacctgga aaagagccta aatgtataac
14881 accagggcag tagctaagaa aattatgaca cattaactga aatgaacatt atgtaaccac
14941 taaaaatcat gattttggag cctgtgatat gtggggaaaa actgacaagt aaaaaagtgg
15001 gttattaact gcacctgctt actctaacgt gaacgcatat gtgaaaaatc tgaaaggaaa
15061 agcacagaaa atggacgttt tcattgaaat tgtcggtgat cttaattttc ctttggtgaa
15121 tatattgctc tcactaaggg cgtttaaaaa atagttcaca ggttttaatt ttttagatga
15181 aatggaccca cagttttctg taagagaaag gagagattgt tatatttgct acttagaata
15241 aaagattttt agccaacgtt gtttcctttt tcaaatattt ttccattttt ttagttgatt
15301 aatgatttag taatttgtgt attgggtttt tttaagaatc agttcttaga ttcatttatc
15361 aattctagtt ttttgttgtt gtttttaag
>rat intron 1 D50092
2879 gtaagcgggctg ctgaagccag gcgtcagcga gcattcagcc ttcctcccgt cgacaagctc
2941 ggcttactgt gcctctccgg gacttgaggc cgcggggctg ggactggggt tgagcttggc
3001 taggaggtgg ctgtgcaccc gctgtgcgcg actcctggag ggaccgaatc ccagggcagc
3061 gaggccggga gccgagcctg attcacagct caacatcgct gtgggggatg gggggttggg
3121 ggggtggcat cttttaactg ccctgtgctg ttttcttctc tcgttgtaat agctacagcg
3181 aacataattt caccccgtga ttccaccacg gtctcatccg tcctcagcac cacactcatt
3241 gctccccttg ctcagtttca tactcagcgc agccgttcgc cttcactgcc ctgcctaggc
3301 gttttcatgg ttgtcttata ttcttttact ttgaatatcg tggtttaata gcagttgccg
3361 gtgtgctaaa ttcctcattt ccttaagaga aactcctggg aggatggaat taaagacgtt
3421 gcaaatttaa ttataccaca aacaggaatc aaaattttgc attaaaatgc cagacatctt
3481 gaaaaattta actattcaat aaaaaaaaaa aaggaactac tttacctaca cacacatccg
3541 agtgcttcaa agagtccaag gaaatagaaa gctaagggat gatttgggtt gtatttgaat
3601 ctgacacgag ctttccatat tatttatagc agggactgaa ggatgagtca ttttctgaat
3661 aagatgcaaa ttaaagcaag tttgttgtct ttacatcgat taaacagaca gagatgatga
3721 cagcagcaac cctaacctag aggttgtctg aaaccaccgt gttcaagttt ggggagcagg
3781 tggccctcct taagagctcg attgattgct ttacaaccaa cgttatgact tggcattgcc
3841 tggggttcct tttatttatt cctttcttta aaagactact atctatttta tgagcatgag
3901 tgtttcgctc cacagaagca tgtatacaag cctggttctg cggaggtcag aagagacagg
3961 gtgttggaag ccctggaact agagctaggg atgattctgt gagcccctgc cacaggggag
4021 ctcagatccc caatccaggc tgtctggaag agcagccaga gctcttaact accgaacacc
4081 ccccccccca tcccctctca ttcacattta gaaaggagaa aactgctacc catgtctggc
4141 atttatttca gagattaact gtgcaaaact cgatgtgaaa gtatactatt ctgtttccca
4201 gtcacactta gttgacagtg taagtcagta agggctttgg ttggttggtt tggttggttg
4261 gttcctgggt tagtctggat gtgcttgttg agagctcaat aacaggcttt caatatggat
4321 atgtagctgg gaattcgcta tgtagaccag gcaggcctca aatttgtggc aatcctccct
4381 gtgattcccc agaatgccct ggtacaggca taagccactg tgcccagccg taaaacaatc
4441 tggtgaggta ttattagttg catgctgtga cccagaaacc ccacttctgg caattcacct
4501 gccgtggtgg aaccaacaaa gggctagggg agccatatgg ccaacagtta cagaaaatta
4561 gatccaaggg aaaagcaacc taaatgttta acaggcgagc agctaagaaa ctgacaggct
4621 cgtgagggag ctgtagcaat cccgaagaac actcttcatt ttagactcca tgtatccctg
4681 ggaaaaacag agtcaaagta caggttagga gaccgggact cctctggacc catgctgtcc
4741 tctgaaaagc ccagaagagc tataatgaaa gagctcagaa gatgtctgat cttggctttc
4801 tttatgtttg ttgctgtatt gtttccacta acaaacaact aaaaaaaaaa aaaaagttca
4861 caggcttctt tccttaaaat actggggatt gaacccaggg atagtttttt agtgtctaaa
4921 ttaacatgac catgccctgt ttgccttttt ggagtatgtt tgaatctgcc cttatttcca
4981 ttctcaaata ctgctccatt ttatatgact atttagtttt ggcttgataa tttgcatatg
5041 agattagatc atctttcagt tctcagactt atttatcaat tctagttttt ctttttgttg
5101 ttttaaag
>mouse intron 1 U29186 8659-10848
t aagcgggctg ctgaagccag gccttggcga gcactcagcc
8701 ttccgtcgtc aagctcggct cactgcgcct ctcggggcct tgaggccacg gggactagga
8761 ctgggactgg gactggggct gagtctggct gggaggtgac tgtacacccc ctgtgcgcga
8821 ctcctggagg aaccgaatcc cagggcagcc aggccgggag ccagcctttc cttcccgagc
8881 cagattcaca gctcagcatc gctggggatg ggggtggcat cttttgactg tccttggctg
8941 ttttcttctc tctttgtagt agctacagcg aacataattt tacctcgtta ttccaccaca
9001 gtcattactc ccttgcacag tttcattctc aacgtcgccg tgcgccttca ctgccctgtc
9061 taggcgtttt catgattgtc tattttcttg tactttgaat accgtggttt aatagcagtt
9121 gcgggtgcgc agaattctcc atttccttaa gagaaactcc tgggagaatg ggactaaaga
9181 cgtgcaaatt taattatatc gcaaacagga atcaaaattt tgcattaaaa tgccaaacat
9241 cttgaaaaat taactattca atgaagaaaa ggaactactt tacctacaca cacatccgag
9301 agcttcgagg aggcgaagga aatagaaagc taagggatga tttgggttgt atttgaatct
9361 gacacaagct ttccatatta tttatagcag ggactaaacg atgagtcatt ttctgaataa
9421 gatgcaaatt aaagcaagtt tgtttgttgt ctttacatct attaaataga cagagacaat
9481 ggcaacagca accctaacct agaggttgcc tgaaagtgtc aggtttggga acaagtggcc
9541 ctgcttaagg gctagaaaga ttgctttaca accaacaatc atgacttgac attgcctggg
9601 gttccttttg tctattcctt ttttaaaaga ctagtgttta ttttatgtgc atgagtgttt
9661 tgcatccaca ttcgcctgta tacacacctg gttctgtgga ggtcaggaga gggtgctgga
9721 tgccctggca ctagagccgt gaatggttat gtgagcccct gccacagggg agctcagaac
9781 caaatccagg tcctctggaa gagcaaccag agctcttaaa acttctaagt atccctccat
9841 cccctttcca tcatatttgg aaaggagaaa actgctaccc atgcctggca tttatttcag
9901 agattaactg tctgtgtaaa acttgacatt gaaagtgcac tattctgttt cccattcata
9961 cttagttgag actactgtaa gtcagttagg gctttttttg tttggttcct tggttagttt
10021 ggagtgtgtt tgtgagctca ttaacaggct ttcagtatgt agctgaaatt tgctgtgtag
10081 accagacagg cctcaaattt gtggcaatcc tccctgcatc ttcccagaat gccctggtac
10141 aggcataaac caccgtgccc agcagtaaaa caatctggtg aggtattatt agtcgtgtgc
10201 tgtgacccag aaaccccact cctggcaatt tactgggaag gaacaaacaa agggctaggg
10261 gagccatatg gcctgcagtt agagaaaatt agatccaact gaaaaatcaa cctaaaggtg
10321 taaaagccaa gcagttaaga aactgacagg ctcatgatgg aagccgaggc catcgtgaac
10381 actcttcatt ttaggcccca cgtatcactg gggacaactg agagtcaaag tacaggtaag
10441 gagaccaagg cttttcagga ctcaggctgt ctcagtgaaa agcccagaag agcagtaatt
10501 gaaagagctc agacgatgtg tctgatctcc tctgtttgtt tgttgctgta ttatttccac
10561 taacttattt gggaggaaaa aaaacagttc acaggcttct tttcttgaaa tactggggat
10621 tgctgggatc gaacccaggg ataggttttt agtttctaaa ataacataga tcatgccctg
10681 tttgcttttt ggaatatgtt tgcgctgccc ttattttcat gttcaaatac tgctccattt
10741 tgcgtgactc tttagtattg gtttgatgat ttgcatatta gattagattg tatttcagtt
10801 ctcagactta tttatcaatt ctagttttct ctttttgttg ttttaaag
>hamster M14055
1 tcgaaaatct ccctctttag caatttcttg ctcctagagt ttcagcaatt gctttctcgc
61 tccattaggc aacctttcat tttctcacct tccccattat gtaacgggag caatgggttc
121 tggaccagtc ttccattaaa gatgattttt atagtcggtg agcgccgtca gggagtgatg
181 acacctgggg gcggtttaaa ccgtacaatc ccttaaacca gtctggagcg gtgactcatt
241 tccccaggga gaagtggcgc ggccattggt gagcacgacg caagccccgc cccacccagc
301 ccggccccgc cctgctaccc ctcctgactc actgccccgc ccgctccccc gcggcgtccg
361 agcagcagac cgagaaggca catcgagtcc actcgtcgcg tcggtggcag gtaagcggct
421 tctgaagcct ggccccggga agggtgctgg agccaggcct cggtaagcct tcggcttccc
481 agagccaagc ccggcttact ccggctctcg gggcgctgag gccgcggggc tgaggttgag
541 tctggctggg aggtgaccgc gcacccgcag ccgcgcgtct ccttgaggga ccgaacccca
601 ggagaggcca ggagccatcc cttcctcccg agcccggctc acccccagag tcgctcgggg
661 atgggggatg ggggatgggg tggcatcttt tgactgtcgt ttgctgtttt cttctctctt
721 tgtaatagct acagcgaaca taattttacc cagggttcca ccgtggtctc gtccgtcctc
781 ggcatctctc agtccagtac atacccaagg
>hamster U78769 177+ exon 2
1 gaacgtgcca tgtttgcttt tgggaatcta tctgagctgt tcttatttcc gttttcaaat
61 actgccccat ttttatgtgc ctgtatttat tagtggtttg gtaatttgta tattagatgg
121 tatttcagta cttagattta ttcatcaatt ctaatttttc tttttcatgt tttgaaggac
181 tcctgaatat attccaaaac tgaacaattt caactgagct gaagtactct gtttttctag
241 aggtaccagt tcagtttagg agagtcacag cagatc
>mouse intron 1 8659-10848 without B1 and B3 elements, blue was sandwiched
t aagcgggctg ctgaagccag gccttggcga gcactcagcc
8701 ttccgtcgtc aagctcggct cactgcgcct ctcggggcct tgaggccacg gggactagga
8761 ctgggactgg gactggggct gagtctggct gggaggtgac tgtacacccc ctgtgcgcga
8821 ctcctggagg aaccgaatcc cagggcagcc aggccgggag ccagcctttc cttcccgagc
8881 cagattcaca gctcagcatc gctggggatg ggggtggcat cttttgactg tccttggctg
8941 ttttcttctc tctttgtagt agctacagcg aacataattt tacctcgtta ttccaccaca
9001 gtcattactc ccttgcacag tttcattctc aacgtcgccg tgcgccttca ctgccctgtc
9061 taggcgtttt catgattgtc tattttcttg tactttgaat accgtggttt aatagcagtt
9121 gcgggtgcgc agaattctcc atttccttaa gagaaactcc tgggagaatg ggactaaaga
9181 cgtgcaaatt taattatatc gcaaacagga atcaaaattt tgcattaaaa tgccaaacat
9241 cttgaaaaat taactattca atgaagaaaa ggaactactt tacctacaca cacatccgag
9301 agcttcgagg aggcgaagga aatagaaagc taagggatga tttgggttgt atttgaatct
9361 gacacaagct ttccatatta tttatagcag ggactaaacg atgagtcatt ttctgaataa
9421 gatgcaaatt aaagcaagtt tgtttgttgt ctttacatct attaaataga cagagacaat
9481 ggcaacagca accctaacct agaggttgcc tgaaagtgtc aggtttggga acaagtggcc
9541 ctgcttaagg gctagaaaga ttgctttaca accaacaatc atgacttgac attgcctggg
9601 gttccttttg tctattccttttcca tcatatttgg aaaggagaaa actgctaccc atgcctggca tttatttcag
9901 agattaactg tctgtgtaaa acttgacatt gaaagtgcac tattctgttt cccattcata
9961 cttagttgag actactgtaa gtcagttagg gctttttttg tttggttcct tggttagttt
10021 ggagtgtgtt tgtgagctca ttaagtaaaa caatctggtg aggtattatt agtcgtgtgc
10201 tgtgacccag aaaccccact cctggcaatt tactgggaag gaacaaacaa agggctaggg
10261 gagccatatg gcctgcagtt agagaaaatt agatccaact gaaaaatcaa cctaaaggtg
10321 taaaagccaa gcagttaaga aactgacagg ctcatgatgg aagccgaggc catcgtgaac
10381 actcttcatt ttaggcccca cgtatcactg gggacaactg agagtcaaag tacaggtaag
10441 gagaccaagg cttttcagga ctcaggctgt ctcagtgaaa agcccagaag agcagtaatt
10501 gaaagagctc agacgatgtg tctgatctcc tctgtttgtt tgttgctgta ttatttccac
10561 taacttattt gggaggaaaa aaaacagttc acaggcttct tttcttgaaa tactggggat
10621 tgctgggatc gaacccaggg ataggttttt agtttctaaa ataacataga tcatgccctg
10681 tttgcttttt ggaatatgtt tgcgctgccc ttattttcat gttcaaatac tgctccattt
10741 tgcgtgactc tttagtattg gtttgatgat ttgcatatta gattagattg tatttcagtt
10801 ctcagactta tttatcaatt ctagttttct ctttttgttg ttttaaag
Nearest human insertion features:
U29185 11511-11800 -Alu-Jo
12634-12767 exon 1
Nearest bovine insertion features:
D26150 1830-1878 -C_OC
<803-855 exon 1
Nearest ovine insertion feature:
U67922 3760-3958 +MLT1F
5666-5717 exon 1
Cow versus sheep
31 May 99 webmaster
The table below shows 3,404 bp of cattle prion containing intron 1 compared to sheep prion. There are no particular difficulties with the alignment; however, without the cervid sequence, there is not a close enough outgroup to allocate events to cow or sheep, respectively.
The 146 point mutations and 63 indels are uniformly distributed. The transitions to transversion ratio, 92:54, is approximately 2:1, similar to coding DNA. However the 144 bp of change due to deletions and insertions is identical to 146 bp of point mutation change; this ratio is much lower in coding DNA where frame shifts are more significant.
The table below gives the point mutation matrix. It is read, "A in sheep occurred 918 times but was found to be C in cattle in 7 places, G in 29 places, etc."
| A | C | G | T | - | totals | |
| A | 918 | 7 | 29 | 5 | 18 | 59 |
| C | 6 | 762 | 9 | 23 | 19 | 57 |
| G | 18 | 8 | 786 | 4 | 19 | 49 |
| T | 8 | 22 | 7 | 938 | 28 | 65 |
| - | 10 | 16 | 17 | 17 | 144 | 60 |
| totals | 42 | 53 | 62 | 49 | 84 | 290 |
| A | 918 | AG | 47 | |||
| C | 762 | TC | 45 | |||
| G | 786 | ti | 92 | |||
| T | 938 | tv | 54 | 146 | ||
| total bp | 3404 | x | - | 144 | ||
| GC | 45% | total | 290 |
The length distribution of indels falls off exponentially, with 53 of 63 events being 3 bp or shorter. Longer indels may arise from slippage of tandem repeats, eg, the overlapping repeat tgatttgtatctgat:
sheep 2299 gaaaxaaaacagagttaggatgtgatttgtatatgatttgtatctgatgcaaatttttca 2357 cow 7154 gaaagaaaacggagttaxxxxxxxxxxtgtatatgatttgtatctgatgcaaatttttca 7203
36 indels of length 1 totaling 36 bp 12 indels of length 2 totaling 24 bp 5 indels of length 3 totaling 15 bp* 2 indels of length 4 totaling 8 bp 2 indels of length 5 totaling 10 bp 2 indels of length 6 totaling 12 bp* 1 indels of length 7 totaling 7 bp 1 indels of length 10 totaling 10 bp 2 indels of length 11 totaling 22 bp 63 indels of 9 types 144 bp (* only 7 indels totaling 27 bp are not frame-shifting)