Pullman Scrapie Test
Mad Cow Home ... Best Links ... Search this site

Pullman scrapie test
Monoclonal antibody: conserved epitope on ruminant prion
Interview with researcher K.I. O'Rourke
New Scientist account
Lancet CJD epidemiology study
Belgium claims case of sporadic BSE
Collected BSE origin hypotheses
SH3 joins the amyloid club
Membrane phospholipid seeds amyloid formation

Pullman scrapie test

Secretary Glickman announces new test to diagnose scrapie in live sheep                                                     
USDA Release No. 0161.98                                     PULLMAN, Wash., April 9, 1998

USDA scientists have discovered thatsheep eyelids hold the key to an easy, relatively inexpensive test fordiagnosing scrapie, a fatal brain disease in sheep, Agriculture Secretary Dan Glickman announced today. "This test will allow producers and veterinarians, for the first time, to easily detect scrapie in sheep before the animals show signs of thedisease," said Glickman. "Until now, scrapie could only be confirmed by examining the brains of dead animals. Clearly, this is an important step toward controlling this disease."

Scrapie is a fatal, degenerative disease affecting the central nervoussystem of sheep and goats. There is no cure or treatment for scrapie andscientists do not fully understand how it is transmitted. Sheep can harbor the disease for up to five years before they show signs such as trembling, incoordination or scraping against objects. Under USDA regulations, producers with confirmed cases of scrapie in their flock often must destroy animals in an effort to eliminate the disease. [This is unclear and seemingly voluntary: the Scrapie Eradication Program was abandoned some years back.]

USDA estimates that the new eyelid test will be performed for about$25 per animal once it is commerically available. Current tests requirebiopsies of internal organs, which is more risky and can cost up to $500 per animal. In developing the test, researchers at USDA's Agricultural Research Service discovered that the third eyelid in sheep collects prions, a type ofprotein believed to cause scrapie. They also designed a new antibody to identify prions in a sample of eyelid tissue. USDA has applied for patents on both discoveries.

"This is another good example of the tremendous impact that long-term investments in research can have on some of the toughest problems facing American agriculture," Glickman said.

ARS microbiologist Katherine I. O'Rourke led the Pullman, Washington-based team responsible for this important work. Others on the team includeDonald P. Knowles, who leads the Pullman lab, Timothy V. Baszler and Steven M. Parish with Washington State University in Pullman, and Janice M. Miller at the ARS National Animal Disease Center in Ames, Iowa.

#For more detailed scientific information, contact Donald P. Knowles, Agricultural Research Service, Animal Diseases Research Unit, 337 Bustad,WSU, Pullman, WA 99164-7030. Telephone (509) 335-6022; fax (509) 335-8328. A USDA fact sheet on scrapie is available.

Scientific discovery may lead to mad cow breakthrough

 Reuters North America  Thu, Apr 9, 1998 By Barbara Hagenbaugh

WASHINGTON - Scientists have discovered an easy method to diagnose a serious brain disease that has been known to kill sheep for centuries, the U.S. Agriculture Department said Thursday, a finding that could someday lead to a diagnosis for mad cow disease.

Researchers, however, cautioned that they have not conducted studies on cows and said a link might never be found.

Scrapie, a degenerative and eventually fatal disease that targets the central nervous systems of sheep and goats, could be easily detected before the animals start to show signs of the disease and before they infect others.

Scrapie has been associated with mad cow disease, or bovine spongiform encephalopathy (BSE), which has killed more than 160,000 cattle and has forced the slaughter of millions more in Britain. Scrapie, BSE and Creutzfeldt-Jakob disease, which targets humans, all involve prions, which are naturally occurring brain proteins that experts say mutate into infectious and dangerous forms, resulting in the diseases.

Researchers at the USDA and at Washington State University discovered that the third eyelid in sheep and goats collects prions and developed a way to test lymphoid tissues for the presence of the proteins.

Researchers said it is possible that someday their discovery could be used to test for BSE. However, they stressed that they have not conducted any research on cows and said that scrapie and BSE act in very different ways when they attack animals.

"Scrapie has been the problem in sheep in the United States and that is where our focus has been," USDA research leader Donald Knowles said. "Any kind of diagnostic test that is made is usually species specific. Any kind of speculation fuels unfair fire."

Scientists think BSE was spread after cattle were fed body parts of sheep infected with scrapie. The scrapie discovery someday may lead to eradication of the disease in sheep and goats in the United States, an important discovery in itself.

"Until now, scrapie could only be confirmed by examining the brains of dead animals," USDA Secretary Dan Glickman said in a statement. "Clearly, this is an important step toward controlling the disease." Scrapie has been discovered in more than 900 flocks throughout the United States, the USDA said. There is no cure for the disease, and producers who discover a sheep or goat with scrapie often must destroy many animals in the flock to stop the spread of the disease.

Controlling scrapie is also complicated by the fact that animals can have the disease for up to five years without showing any signs that they have been infected. It is hard to estimate how many sheep and goats have been killed by scrapie because researchers estimate that a large number of animals that die of the disease are never properly diagnosed.

The new method is still winding its way through the regulatory process and researchers said it is unclear when the test will be put into practice. The new test will cost approximately $25 per animal. Biopsies can cost as much as $500, USDA said.

Commentary/webmaster/9 Apr 98

The Pullman test, described today, seemingly describes a non-invasive pre-clinical $25 sheep test, on third eyelids where prions (plausibly enough) accumulate in lymphoid tissue. There is no indication of where the study is published. DP Knowles previously worked on scrapie and TME transmission to cattle, J Comp Pathol 1995 Oct;113(3):241-251 and is senior author on yesterday's posting to GenBank in press at J. Clin. Microbiol with the good-for-all-ruminants monoclonal antibody, also has worked on Anaplasma marginalis in eastern Oregon cattle.

They are making it quite clear that only sheep have been studied at this time. Does the USDA really want to test US cattle? What if they found something???

"Scrapie could be easily detected before the animals start to show signs of the disease and before they infect others."

The first part sounds great; the second like wishful thinking -- it is not part of the Glickman's press release. The test would have to be awfully sensitive to detect it before _any_ transmission could occur, though removing infected sheep at any stage cannot but help. It is doubtful whether this concept has been demonstrated in field studies.

The third eyelid (membrana nictitans) moves passively in sheep, actively in bird, intermediately in cat. Its function is to spread tear film, provide mechanical protection, allow lacrimal secretions, and aid immune system functions. It is innervated by the sixth cranial nerve and sypathetic neurons and contains a gland.

Lancet CJD epidemiology study

Thu, 9 Apr 1998 
Three articles are available as full text to non-subscribers (but registered) in this issue of Lancet. There is a major epidemiological piece on CJD and risk exposures in Europe, plus an item on leukodepletion and Australian compensation. Risk factors included eating brain and raw meat etc but the effects were not dramatic here or elsewhere. 405 cases of European CJD were studied of which 14 had a mutation (in the coding region), too low at 3.5%.

The Lancet is doing a moderated discussion forum for the main article -- e-mail in comments, these are moderated by the journal's editorial staff and published on the site twice a week. You must be a subscriber to read and take part in discussion groups, for $115. Odd that non-subscribers can't at least read the comments because they will never be available in print.

The pig association has been seen in at least two earlier studies, Devanipour and Bobawic [spp?] so I don't know why it comes as such a big surprise to the Meat and Livestock Commission to see it again.

There is no bottom line to the study: how many of the sporadic CJD cases can be attributed to their risk factors and how many are left over.

Pullman scrapie test details

16 Apr 98 webmaster interview with Dr. Katherine O'Rourke, WSU, Pullman 
1. A monoclonal antibody to a prion peptide was used. This is the only way to go if the method is to be consistently transferable to different labs and never run out of antibody. It does not distinguish rogue from normal conformer like Swiss 15B3 but works adequately in US sheep third eyelid lymphoid tissue, apparently. Despite the patents, this antibody is readily available to any qualified researcher: .

2. Their main method was to purchase "high-risk" lambs from a 1000 mile radius of Pullman, Washington. These amounted to lambs born to ewes with confirmed scrapie, be it maternal or from shed agent. The test works at the 18 month level; these sheep typically display scrapie at 3 years or longer, so it is a real breakthrough in terms of non-invasive pre-clinical "on-the-hoof" testing. 14-3-3 is not competitive in this regard. Having a test at 18 months is not the total answer to eradicating scrapie, but it can't help but help. The slow-onset carrier problem continues to be vexatious.

3. There will be a conventional peer-reviewed paper out in a couple of weeks. The journal editor does not wish to be bothered by the press in the interim so the journal name is not being given out. I am guessing that the high-risk lambs had dramatically higher total eyelid prion than low-risk lambs and that the alleles carried are known high-risk. The June issue of the J. Clin Microbiol. is apparently a different article.

Ruminants differ from primates in that there is tremendous activity in Peyer's patches during the first days as opposed to wholesale uptake of IgG across the placenta, it is absolutely imperative that the lamb's immune system be primed against infection early on.

4. The elk GenBank releases that coincided with the press release were just that, a coincidence and desk-cleaning. However, the lab is now focused on elk ranch CWD where they are getting excellent cooperation from an industry that wants eradication. Seems that elk produce far less prion than, say, mule deer, and the eyelid test may not work on them though tonsils could. GA Wells is looking into applicability of the eyelid test to UK scrapie, no one is saying at this point that the test will work on UK strains of scrapie.

This is an interesting point put forward by O'Rourke, that different species may inherently produce different basal levels of normal prion protein, leading to differential susceptibility through mass action. O'Rourke suggest, for the origin of CWD, that mule deer population genetics could be so localized that a bad allele might have surfaced; while this is not totally inviable, I see severe selection working against this as deer are struck down in their reproductive prime.

5. They are not calling this an official 'test' yet pending the fate of various control sheep that tested negative on the eyelid test, false negatives and all that, with the limitation that the sheep cannot be housed in separated pens that meet federal standards due to the limited size of eastern Washington; however, the incubation period is long enough that conclusions can still be somewhat safely drawn.

6. They have their hands full with scrapie and CWD aspects and are not working on extending the test to BSE at this time. Without getting into comparative third eyelidology, the test is not applicable to CJD. Again, the sampling takes 25 minutes with two people and does not require general anesthesia; antibody is available to any qualified researcher.

7. There has also been some dramatic improvements at ARS, Ames, Iowa, in the form of Dr. Mary Jo Schmerr's latest capillary electrophoresis immunoassay with fluorescent peptides, Electrophoresis 1998 19 409-414, which is specifically for the rogue isoform.

The eyes have it

Apr. 25/98
New Scientist
Jonathan Knight

A skin sample taken from a living sheep's eyelid can reveal whether it will develop the deadly disease scrapie and a similar test may also help spot cattle with mad cow disease before they show symptoms. The story noted that a related test for scrapie was already under development but this test, from a Dutch team (New Scientist, print edition, 15 June 1996, p 5), involved extracting sheep's tonsils under a general anaesthetic and has to be done by a veterinary surgeon.

The new test is simpler and cheaper. The article said that the eye is anaesthetised with a spray and a half-centimetre fold of skin is clipped from the surface of the inner eyelid, or nictitating membrane. The samples are tested for PrP, a protein known to accumulate in an abnormal form in the brain and parts of the lymphatic system, such as the spleen and tonsils, in animals with scrapie, BSE and other transmissable spongiform encephalopathies.

Katherine O'Rourke and Donald Knowles of the US Department of Agriculture's Agricultural Research Service in Pullman, Washington, have discovered that PrP also accumulates in lymphatic tissue of the inner eyelid of sheep incubating scrapie. This structure is present in sheep, cows and some other mammals but not in people.

The researchers took samples from about 100 sheep and tested for PrP using a monoclonal antibody that binds tightly to the protein. Around a third of the sheep came from flocks known to harbour scrapie. One year later, 10 per cent of the animals had developed symptoms of the disease. All of these had tested positive for PrP, while none of the sheep that tested negative developed the disease.

The article stated that sheep farmers in the US could be using the new test within a year. Currently, flocks suspected of harbouring scrapie must be quarantined and are put under surveillance for between five and six years. Paul Rodgers, director of animal health with the American Sheep Industry Association in Christiansburg, Virginia said, "That's very cumbersome and expensive." The eyelid test may make it possible to destroy scrapie-infected sheep before they have a chance to spread the infection. "We think it's going to be one of the important tools in the eradication of scrapie," said Rodgers.

The article continued saying British officials would like to eradicate both scrapie and BSE. Jeffrey Almond of the University of Reading, a member of the government's Spongiform Encephalopathy Advisory Committee, said he wants to know whether the eyelid test also works in cows, and whether it could identify animals with prion diseases several years before they develop symptoms.

Knowles said his group has recently detected PrP in samples from sheep less than one year old, which suggests that it may provide accurate early diagnosis. He also hoped to try the test on British cattle to see if it can predict which animals will develop BSE.

Scrapie test shows promise

Apr. 23/98
Manitoba Co-operator
Jim Romahn
In a related article, it was reported that sheep farmers are happy that researchers are developing new tests that can identify scrapie disease. Kelly Maloney of the Ontario Sheep Marketing Agency, based in Guelph, said, "It's very good news." The article said that if the research tests prove practical, it will give farmers the tool they need to eradicate a disease that has been a major plague. Until now, there has been no accurate test to diagnose scrapie while sheep are still alive, so it has been next to impossible to get rid of the disease once it shows up in a flock. That's why the popular approach has been to slaughter the entire flock and start over again but that's an approach that has wiped out valuable breeding stock, not to mention the livelihood of many shepherds.

Maloney said there are promising results from two quite different approaches. One was under way at the University of Toronto but is still a long way from producing a practical test for farmers and the other has been announced by U.S. Agriculture Secretary Dan Glickman, who hailed it as a major advance for the sheep industry.

Glickman said the test is relatively cheap and easy to perform and said it "will allow producers and veterinarians, for the first time, to easily detect scrapie in sheep before the animals show signs of the disease. Until now, scrapie could only be confirmed by examining the brains of dead animals. Clearly, this is an important step toward controlling this disease." The article noted that there is no cure or treatment for scrapie and scientists do not fully understand how it is transmitted among sheep and goats. Sheep can harbor the disease for up to five years before they show signs such as trembling, incoordination or scraping against objects.

The story went on to say that both U.S. and Canadian government officials will quarantine a flock that is believed to be infected with scrapie but because there has been no reliable test for live animals, it has been hard to determine when and if a quarantine should be lifted. One of the results has been a reluctance among farmers to report scrapie symptoms. That, in turn, has made it more difficult to prevent the disease from spreading.

USDA estimated that the new eyelid test will be performed for about $25 per animal once it is commercially available. Current tests require biopsies of internal organs, which is more risky and can cost up to $500 per animal.

In developing the test, researchers at USDA's Agricultural Research Service designed a new antibody to identify prions in a sample of eyelid tissue. USDA has applied for patents on both discoveries.

New CJD study attacked as `illogical'

PA News Thu, Apr 9, 1998   By John von Radowitz, Medical Correspondent
Unexplained links between CJD and raw meat, some fertilisers and exposure to leather were revealed today in the biggest ever study of risk factors for the disease. But the surprising findings were immediately attacked as "inconsistent and totally illogical".

A collaborative study collected data on 405 patients with probable or definite CJD in Britain, Belgium, France, Germany, Italy and the Netherlands between 1993 and 1995. The results, published in the Lancet medical journal today, showed no evidence of an increased risk of CJD associated with eating beef, veal, lamb, cheese or milk.

However in the overall analysis, frequent exposure to leather products other than from wearing clothes, was significantly associated with CJD. Exposure to fertilisers which contained hoofs and horns was also reported significantly more often for CJD patients than for a healthy control group.

Another inexplicable finding showed a slight increase in CJD risk the more people ate pork. This was despite the fact that pigs are not known to suffer any animal diseases of this type, such as BSE or the sheep illness Scrapie.

The authors, who included scientists from the CJD Surveillance Unit in Edinburgh, said: "Each of these three findings lack a plausible biological explanation and need to be confirmed."

But the Meat and Livestock Commission (MLC) attacked the results. John Pratt, chief veterinary adviser for the MLC, said: "It appears leather shoes and lederhosen are perfectly okay, but leather furniture is not. "This appears to be beyond any form of sense or reason. Either the research is deeply flawed or has been interpreted incorrectly - I cannot believe these results bear any relation to reality."

The research, which did not distinguish between different types of CJD, underlines how little is known about the horrific brain illness. But although some risk factors -- including contact with leather products other than clothes -- were described as "significant", the investigating scientists said the results should be "interpreted with great caution".

New variant CJD -- nvCJD -- the novel strain believed to be linked with BSE-infected beef, was not thought to feature in the findings because it was not made public until 1996. Most cases of CJD, known as sporadic, occur spontaneously and have no known cause. Others have been linked to genetic factors and some are transmitted through treatment with human-derived hormones, neurosurgery and cornea transplants.

Last year there were 59 cases of CJD in the UK, of which 40 were sporadic, six were linked to medical procedures, three were inherited and 10 were new variant.

Dr Cornelia van Duijn, from Erasmus University Medical School, in Rotterdam, Holland, who led the research, admitted some of the surprise findings might be due to coincidence or reporting bias. Even significant links could reflect a "statistical fluke" rather than a genuine cause and effect, she said.

The fact that general exposure to leather emerged as a significant risk factor when working with leather posed no special risk was especially puzzling. She added: "We are working with statistics, so to really say we have found a causal relationship is difficult. All we can say is what is plausible from what we know of the disease."

Monoclonal antibody F89/160.1.5 defines a conserved epitope on the ruminant prion protein

J. Clin. Microbiol (1998) In press
O'Rourke,K.I., Baszler,T.V., Miller,J.M., Spraker,T.R.
 Agricultural Research Service  Washington State University, Pullman, WA
These elk sequences just posted genbank differ solely at codon 129, met to leu, ATG to TTG (which is codon 132 in ruminants). The abstract of the forthcoming paper is not available on medline yet. Possibly this conserved ruminant epitope is what they use in the third eyelid scrapie test, in which case it should work in CWD and bovine TSE as well.

There could be some effect of this allele in CWD susceptibility. One guesses met/met > leu/leu > met/leu.

>gi|3033480|gb|af016227|af016227 cervus elaphus nelsoni prion tac atg c 132m
tgcaagaagcgaccaaaacctggaggaggatggaacactggggggagccgatacccgggacagggaagtcctggaggcaa
ccgctatccacctcagggagggggtggctggggtcagccccatggaggtggctggggccaacctcatggaggtggctggg
gtcagccccatggtggtggctggggacagccacatggtggtggaggctggggtcaaggtggtacccacagtcagtggaac
aagcccagtaaaccaaaaaccaacatgaagcatgtggcaggagctgctgcagctggagcagtggtagggggcctcggtgg
ctacatgctgggaagtgccatgagcaggcctcttatacattttggcaatgactatgaggaccgttactatcgtgaaaaca
tgtaccgttaccccaaccaagtgtactacaggccagtggatcagtataataaccagaacacctttgtgcatgactgtgtc
aacatcacagtcaagcaacacacagtcaccaccaccaccaagggggagaacttcaccgaaactgacatcaagatgatgga
gcgagttgtggagcaaatgtgcatcacccagtaccagagagaatccgaggcttattaccaaagaggggcaagtgtgatcc
tcttctcctcccctcctgtg

>gi|3033482|gb|af016228|af016228 cervus elaphus nelsoni prion tac ttg c 132l
tgcaagaagcgaccaaaacctggaggaggatggaacactggggggagccgatacccgggacagggaagtcctggaggcaa
ccgctatccacctcagggagggggtggctggggtcagccccatggaggtggctggggccaacctcatggaggtggctggg
gtcagccccatggtggtggctggggacagccacatggtggtggaggctggggtcaaggtggtacccacagtcagtggaac
aagcccagtaaaccaaaaaccaacatgaagcatgtggcaggagctgctgcagctggagcagtggtagggggcctcggtgg
ctacttgctgggaagtgccatgagcaggcctcttatacattttggcaatgactatgaggaccgttactatcgtgaaaaca
tgtaccgttaccccaaccaagtgtactacaggccagtggatcagtataataaccagaacacctttgtgcatgactgtgtc
aacatcacagtcaagcaacacacagtcaccaccaccaccaagggggagaacttcaccgaaactgacatcaagatgatgga
gcgagttgtggagcaaatgtgcatcacccagtaccagagagaatccgaggcttattaccaaagaggggcaagtgtgatcc
tcttctcctcccctcctgtg

Belgium claims case of sporadic BSE

 Reuters World Report Thu, Apr 9, 1998
BRUSSELS - The Belgian Agriculture Ministry said on Thursday it could find no precise cause for a case of "mad cow" disease found in Belgium earlier this year and concluded it was a "sporadic case." Belgium has reported three cases of mad cow disease, or bovine spongiform encephalopathy (BSE), since the first case was announced in October last year.

The Agriculture Ministry said that, on the basis of the three recorded cases, a consultative group set up by the Belgian government believed that "no conclusion can be drawn about the future development of BSE in Belgium." The ministry announced the results of an investigation into Belgium's second case of BSE, at Ruddervoorde in western Flanders, which was confirmed on March 10.

It said it seemed unlikely the disease had been transmitted from the cow's mother. Cattle feed used at the farm contained no animal meal and investigators could find no other likely cause in the management of the farm, it said in a statement. That only left the possibility that this was a "sporadic case," meaning a case whose origin could not be linked to an exact cause, the ministry said.

Since 1994 when a BSE monitoring system was created, 139 cows had been registered at the farm which had the BSE case. Of these, 50 cattle at the farm at the time were destroyed. Tests for BSE on these slaughtered cattle had so far been negative. Of the rest, four calves were found to be still alive in Belgium and these were destroyed, the ministry said. Another 20 cattle had been exported. "The countries concerned have been immediately informed about this," the ministry said, without specifying the countries.

The ministry said it was still investigating the latest BSE case, at Waarschoot, eastern Flanders, announced on March 30. The 124 cattle at this farm had been slaughtered and incinerated. The brains of the 76 animals more than two years old were being examined to see if they carried BSE, it said. Investigators seeking the origin of this case were focussing on another farm in the same area where the cow was born before being sold in 1996.

The investigators traced 17 cattle still alive in Belgium and 29 which had been exported from the farm where the BSE case was found. They also traced 43 cattle still alive in Belgium and 38 exported from the farm where the cow was born. All of these were being destroyed and incinerated, the ministry said.

Collected BSE origin hypotheses

20 Apr 1998 Steve Dealler hypothesis page
Dealler has put together a list of the various hypotheses for the origin of BSE (most of them raised at the Inquiry) and brief pros and cons for each. A good start on this.Be good if someone did the same for diagnostic methods and for tracking therapy ideas.

Some interesting new gossip on his page for April, including quantitation of the unsuitability of the mice used to test tissues for infectivity, could be off by factor of 100,000.

Also Rocky Mtn lab seems to be looking at various chemicals capable blocking in vitro conversion, with results due out soon.

Prusiner will testify on June 6, 1998 at a special weekend session of the Inquiry.

SH3 joins the amyloid club

21 April 98 webmaster commentary
An article in the most recent PNAS Vol. 95, Issue 8, 4224-4228, April 14, 1998 by Guijarro et al .establishes that a very common protein domain, called src homology domain 3 or SH3, is capable of making the transition from normal isoform to cross-beta congophilic fibril. At this point, there is no known disease associated with this in the particular protein examined, tyrosine kinase, and pH conditions were unphysiological (2.0).

Typical SH3 topology is two short antiparallel beta-sheets packed almost perpendicular to each other. The function is to bind to proline-rich domains in a second protein for the purpose of propagation of intracellular signals from various transmembrane receptors. Protein binding to dynamin and clathrin assembly protein adaptin suggest a role for Src in neural membrane traffic events mediated by dynamin and the synapsins

GenBank has further improved itself and now there are direct links to coordinates where these have been determined, links that then launch your prefered molecular viewer. Below is a snapshot of one of these that illustrates the two perpendicular beta sheets.

For a very recent structure determination, see

Solution Structure of the Human Hck SH3 Domain and Identification of its Ligand Binding Site

JMB Volume 278 Number 1, April 24 1998 p 253-265 
David A. Horita, Donna M. Baldisseri, ... R. Andrew Byrd 
SH3 domains are protein binding domains that occur widely among signal transduction proteins. Here, we present the NMR-determined solution structure of the SH3 domain from the cytoplasmic protein tyrosine kinase, Hck. Hck is involved in a number of cell signal transduction pathways, frequently in pathways associated with immune response. SH3 domains bind proteins via a left-handed polyproline type II helix on the target protein. We have assessed the structural impact of binding to a ligand through addition of a peptide corresponding to a proline-rich region of a Hck target, the GTPase activating protein of the Ras pathway....

It should not be assumed that all 805 entries in GenBank for SH3 are homologous. The fold here is simple enough that it may have arisen independently in different proteins and different lineages.

The authors are of the opinion that "amyloid formation may be a common property of globular proteins (under appropriate conditions) and that it is not a rare, exclusive property of a few proteins that are disease-associated."

On the other hand, if there are thousands of proteins with SH3 domains, perhaps one or more will show up eventually as amyloid disorders. Overall, this paper is good support for the views of GG Glenner on conformational disorders and that prion conformational changes are unremarkable as protein chemistry.

and Inositol Involvement in Alzheimer Amyloid-[Beta] Fibril Growth and Arrest

JMB Volume 278 Number 1, April 24 1998 p 183-194 
 J. McLaurin, T. Franklin, A.  Chakrabartty, P. E. Fraser
A key pathological feature of Alzheimer's disease is the formation and accumulation of amyloid fibres. The major component is the 39 to 42 residue amyloid-[Beta] peptide (A[Beta]) which is an internal proteolytic fragment of the integral membrane amyloid precursor protein. Aggregation of A[Beta] into insoluble amyloid fibres is a nucleation-dependent event that may be modulated by the presence of amyloid-associated molecules. Fibril formation is also associated with neurotoxicity which may be the result of specific A[Beta] interactions with membrane proteins and/or lipids.

Using circular dichroism spectroscopy, tyrosine fluorescence spectroscopy and electron microscopy, we have examined the binding of A[Beta] peptides 1-40 (A[Beta]40) and 1-42 (A[Beta]42) to the glycolipid, phosphatidylinositol (PI), and different inositol headgroups.

At pH 6.0 and in the presence of PI vesicles, both A[Beta]40 and A[Beta]42 adopted an amyloidogenic [Beta]-structure. In contrast, at neutral pH only A[Beta]42 folded into a [Beta]-structure in the presence of PI vesicles. To determine whether the induction of [Beta]-structure stemmed from interactions with the headgroup of PI, the effects of inositol derivatives on A[Beta] were also examined. At pH 7.0, myo-inositol was sufficient to induce [Beta]-structure in A[Beta]42 but had no effect on the conformation of A[Beta]40. Myo-inositol may promote [Beta]-structure as a result of its ability to be both a hydrogen-bond donor and acceptor. Mono-, di- and triphosphorylated forms of inositol had reduced ability to induce [Beta]-structure in both peptides.

The results from this study indicate that interaction of A[Beta]40 and A[Beta]42 with PI acts as a seed for fibril formation while myo-inositol stabilizes a soluble A[Beta]42 micelle.

Folding of [Beta]-Sheet Membrane Proteins: A Hydrophobic Hexapeptide Model

JMB Volume 277 Issue 5 - April 17 1998   p 1091 - 1110
William C. Wimley, Kalina Hristova,... Stephen H. White 
Beta-sheets, in the form of the [Beta]-barrel folding motif, are found in several constitutive membrane proteins (porins) and in several microbial toxins that assemble on membranes to form oligomeric transmembrane channels. We report here a first step towards understanding the principles of [Beta]-sheet formation in membranes. In particular, we describe the properties of a simple hydrophobic hexapeptide, acetyl-Trp-Leu5 (AcWL5), that assembles cooperatively into [Beta]-sheet aggregates upon partitioning into lipid bilayer membranes from the aqueous phase where the peptide is strictly monomeric and random coil. The aggregates, containing 10 to 20 monomers, undergo a relatively sharp and reversible thermal unfolding at [sim]60°C. No pores are formed by the aggregates, but they do induce graded leakage of vesicle contents at very high peptide to lipid ratios.

Because [Beta]-sheet structure is not observed when the peptide is dissolved in n-octanol, trifluoroethanol or sodium dodecyl sulfate micelles, aggregation into [Beta]-sheets appears to be an exclusive property of the peptide in the bilayer membrane interface. ...

This surprising finding, that a simple hydrophobic hexapeptide readily assembles into oligomeric [Beta]-sheets in membranes, reveals the potent ability of membranes to promote secondary structure in peptides, and shows that the formation of [Beta]-sheets in membranes is more facile than expected.

Furthermore, it provides a basis for understanding the observation that membranes promote self-association of [Beta]-amyloid peptides. AcWL5 and related peptides thus provide a good starting point for designing peptide models for exploring the principles of [Beta]-sheet formation in membranes

Mad Cow Home ... Best Links ... Search this site