Poster sessions at Iceland meeting
Sept 28, 1998 meeting on risk analysis for BSE in the United States
Mouse IAP retrovirus
A 3' UTR mariner element is found in cow too
Appendix provides opportunity
Infectivity in blood components
The CDC plays blood politics
Unknown group patents diagnostic method
Val/val associated with loss of mental ability
Copper, GuHCl, and infectivity
New chromosomal location of prion gene
Cleaning CJD-Contaminated Instruments
The August 1998 TSE meeting in Iceland had 59 poster talks. These did not make it onto the meeting web site and conference organizers have declined to make them avalable to non-attendees. However, someone in Europe sent a full set of abstracts along with handwritten margin notes.21 Sept 98 webmaster opinion
There were many sessions devoted to correlating sheep codons 134-154-171 to scrapie susceptibility in this or that flock or breed. This is a complete waste of time of course, because:
Posters P10 and P11 and talk T56 from the Goldmann-Hunter group addressed control regions. They found the 3' UTR had tissue-specific use of alternative polyadenylation sites that differed signficantly in their translation efficiency and regulation during development. They note further, "Additional RNA processing in other postitions of the untranslated regions has been found resulting in a complex system of post-transcriptional modulation of PrP expression [ruminants only].... A parallel study of PrP polymorphisms revealed a high variability in the 3' UTR within and between breeds..." This was investigated further with 3' UTR deletions. The mRNAs are given as 4.6kb and 2.1 kb in P10 which are said to differ by 2.3kb in T56. Online poly-A software could probably find the alternative site if it was only known what sheep sequence they were using.
A 524bp sheep promoter fragment was studied with a reporter gene and a series of deletions. A mutation G to T at -96 knocks out the single AP-2 and conveniently a Sma1 restriction site. A single SP-1 was found at -48. [These numbers make no sense relative to sheep U67922, probably because of exon 1 has a ragged start: -96=cccgggcgcccgcagcgggcgcgcctgagcgtgcgcgcgccgtcgcctc -48=cccccccccgcagctcctcctctgcacggcgactcaccagccctagt start of exon 1.] They are now looking at genotype and breed promoter variations. Exon 1b was not mentioned nor the role in sheep of +123 to +891 of intron 1. Bovine have three potential binding sites for the transcription factor Sp1 [Inoue S et al, J Vet Med Sci 1997 Mar;59(3):175-183]
The bovine prion gene is such a touchy subject that none of the hundred papers here dared to address it. Only Japanese researchers are able to study it in peace. God forbid that anyone determine the nature and extent of the BSE-correlated polymorphism found by Womack's group. Fortunately the bovine control regions are very similar to sheep.
New alleles were found in the course of screening a fragmentary ORFs of thousands of sheep: S138N and R151C in Iceland. Poster 39a looked at subclinical scrapie, finding 14 asymptomatic sheep showing 'asymmetrical' histological indication of scrapie at median age 51 months, none were AHQ.
French researchers, poster P2, have knocked sheep alleles into mice under control of a known promoter. At Poster 51, a double recomination gene targeting technique allowed J. Manson et al to put in point mutations at will, apparently leaving UTR regions constant, an absolute necessity. They have just about settled the Sinc = PrnP issue, changing mice to L108F T189V with recovery of incubation times and disease profile against two strains of scrapie. They are now pinning down the source of incubation time variability by looking at single changes.
Schreuder, Smits in poster P58 report on detecting VRQ scrapie in tonsils up to 1.5 years before clinical symptoms appear, or at about half or one third of the incubation period.The frustrating history of scrapie eradication in Iceland, with its quarantine zones that still allowed movement of hay, is most instructive, poster 41. Scrapie came to Iceland in 1878 in an Oxford down ram.
Stefan Weiss and collaborators had seven reports on the aptamer, laminin receptor, or prion dimer fronts, talks 13, 14, 15 and posters P4, P8, P12, and P13. They are reporting evidence for prion homodimers in vivo, using Semlike Forest Virus vectors or yeast two hybrid bait against various mutations and cross-species, reporting that the repeat region and copper plus a downstream domain are important to dimer formation, not quite what Warwicker had. One can only hope they ruled out trimer, tetramer, ... by sizing.
LRP has moved beyond colocalization and antibody interference to the point of trans dominate negative LRP mutations. Why LRP and why LRP-prion uptake by neuroblastoma cells have no satisfactory explanation or motivation given what is known about laminin receptor protein.
RNA aptamers, which are like antibodies but with better diagnostic and therapeutic possibilities, have now been selected against SAFs. These fibrils are said to have been found by Fournier in the French case of nvCJD. A rather specific aptamer against hamster 23-89 was also selected.
There were some interesting developments on biochemical strain-typing, which is still in its infancy. A French monoclonal Pri917 against 214-230, poster P3, improved on 3F4 by additionally detecting bands of lower molecular weight lacking upstream peptides and working in other species besides hamster and human. People are too lazy to tackle the glycosylations themselves, though MALDI works fine on picograms of material; the Laramie group did look, poster P15, with lectins as cheap detectors, at carbohydrate moieties in sheep, hamster, elk, and deer. There are species and isoform differences of course.
In poster P6, the Groschup group found wide differences in localization of deposition yet consistancy of glycotyping patterns, with BSE in mice having lower mass bands than any scrapie strain tested. [In P5 they found a monoclonal specific to the tyr at 148 which is trp in rodents but not guinea pig which remains unsequenced. This residue is at the beginning of helix 1.]
In poster P17, Tuzi et al are testing whether like-like extends to glycosylation, whether 'the infectious agent could target the neurons which the express the same glycoforms of PrP as itself.' It looks like they are headed towards knocking out one or both asn sites in mice to simplify life.
The meeting was a bit odd in that there was basically no one there from North America or Japan. Prusiner gave a plenary talk but there was no news from the 75-person lab (there has not been any for many months). The abstract had nothing in it except a puzzling statement that Alzheimer, Parkinson, and ALS might someday be shown to be 'caused by changes in protein conformation,' perhaps not remembering papers co-authored as a junior colleague of GG Glenner back in 1980. Is not ALS as just an ordinary mutation in mitochondrial superoxide dismutase?
The person taking notes in the margin has helix B and C interacting in the rogue conformer as shown by phage display antibody. 'Protein X' is studied (in crude cavaeoli extracts?) with time -resolved fluorescence (of trp?) but there has been no progress in identifying the gene. There is a new concept: a 'mini-prion' which starts at 106 and is transmissive. This would be a bit like Y145stop which they don't like because it suggests the "increased beta sheet" story might be an irrelevent artifact of longer prion fragments.
Weissmann gave a detailed talk on various cell types and fractions of spleen such as B, T and follicular dendritic cells and stroma, getting 1 LD-50 per 500 cells. They puzzled over why circulating leucocytes then had less than 1 unit per million cells. In talk 26, an Edinburgh group looked further at FDCs in chimeric SCID mice, concluding that display of PrP depended not on the status of the graft but only on that of the recipient.
A Heidleberg group looked at del 114-121 as a recruitment spoiler, in talk 18. It itself reaches the cell surface with a GPI anchor and cannot be recruited. When over-expressed, it did reduce levels of rogue conformer though the basis for this wasn't established. Meanwhile, poster 18, the Gottingen group were replacing the neurotoxic domain conserved palindrome AGAAAAGA with GGGGGGGG and AAAAAAAA. They state that 106-126 is not neurotoxic in null mice -- a key control that rules out many scenarios. A French-Belgium group looked a little downstream at 118-135, which they incorrectly say is homologous to the C-terminal domain of Alzheimer beta-amyloid peptide. This fragment of prion protein seems toxic on its own.
Remember the in vitro conversion study that created such a stir last year? You knew there had to be a sequel -- it is here as poster 16: Bossers, Raymond, Caughey, and Smits. It seems that they have extended the method to more species, sheep variants, and point substitutions. Cell-free conversions continue to correlate well with known inter- and intra-species transmissibilities which suggests that predictions to unknown situations could have value. They rightly expand the species barrier concept to encompass a polymorphism barrier. Few new details are given.
Dealler gave poster talk 52 on statistical methods for estimating under-reporting of BSE. The underlying cause was taken as the ability by 1991/92 of farmers with large herds to recognize a sick cow very early on, through experience with the disease. This led to a marked change in the formerly stable age distribution of BSE cases. Calculating on this basis gave under-reporting of 30% in 1992 escalating to 80% in 1996. Even with this correction, the number of cases is dropping rapidly; the final outcome remains hard to predict.
P55 pg 104 by MC McElroy, CVRL Dublin: "An on-farm clinical examination was performed on 31 dairy and 8 suckler cows in which a diagnosis of BSE was subsequently confirmed. A detailed clinical history was take from the farmer. The cows had a combination of gnenerald and neurolgoical signs. Thirty-five (90%) had lost weight and 23 (82%) of the lactating dairy cows had decreased milk yield....."
Another yeast two hybrid screen, here to sheep 24-232, was reported by an Iceland group. They recovered a gene dJ1409.2 with homology to needin, a neuronal growth suppressor and also to KIAA0570, a large protein expressed in brain of unknown function. This is well and good but why are different groups not recovering the same proteins with this method?
There are quite a few more studies with good snippets of information but I have run out of steam for writing them up. Overall, if this meeting provides a snapshot of the state of TSE research worldwide, we are really in trouble. It has been taking 18-24 months and longer for meeting talks to emerged as printed journal word. There are many important gaps in research coverage, major mis-allocations of the workforce, enormous duplication of effort, and enormous wasted effort.
Serious contingency planning is needed right now on how to redirect research resources away from this bumbling paradigm, should nvCJD start to rise (which it could do at any time). This would probably take the form of a research czar and mandatory coordinated task allocation. Frankly, I see a tremendous gap between this stack of abstracts and what needs to happen to get on top of this disease in a timely manner.
September 17, 1998 Federal Register Vol. 63 No. 180 USDA - FSISAGENCY: Food Safety and Inspection Service; Animal and Plant Health Inspection Service, USDA.
ACTION: Notice; request for comments.
SUMMARY: The Food Safety and Inspection Service (FSIS) and the Animal and Plant Health Inspection Service (APHIS) are announcing that they will hold a public meeting to assess Department of Agriculture (USDA) measures to prevent Bovine Spongiform Encephalopathy (BSE) from entering the United States and endangering the U.S. food supply. On April 24, 1998, USDA entered into a cooperative agreement with Harvard University's School of Public Health to conduct a risk analysis to assess the potential pathways for entry into U.S. cattle and the U.S. food supply, to evaluate existing regulations and policies, and to identify any additional measures that could be taken to protect human and animal health. This meeting will provide an opportunity for public input and a chance to comment on the scope of the BSE risk analysis project.
DATES: The meeting will be held from 9:30 a.m. to 12:30 p.m. on September 28, 1998.
ADDRESSES: The September 28 meeting will be held at the National Rural Electric Cooperative Association, 4301 Wilson Boulevard, Arlington, VA 22203-1850; telephone (703) 907-5500. To register for the meeting, contact Ms. Jennifer Callahan by telephone at (202) 501-7251 or by FAX at (202) 501-7642. If a sign language interpreter or other special accommodation is needed, contact Ms. Callahan at the above numbers by September 21, 1998. Persons wishing to present technical data at the public meeting are asked to bring 100 copies of their data for distribution to participants in the meeting and to submit one original and two copies of the data to the FSIS Docket Clerk, Room 102, Cotton Annex Building, 300 12th Street, SW, Washington, DC 20250-3700. All other written comments should be submitted to the FSIS Docket Clerk at the above address.
FOR ADDITIONAL INFORMATION CONTACT: Dr. Ruth Etzel, Director, Epidemiology and Risk Assessment Division, Office of Public Health and Science, at (202) 501-7472 or by FAX at (202) 501-6982.
SUPPLEMENTARY INFORMATION: BSE is a progressive neurological disorder of cattle that results from infection by an unknown transmissible agent. Although the nature of the transmissible agent is unknown, a theory which has gained increasing acceptance is that the agent is a modified form of a normal cell surface component known as the prion protein, a pathogenic form of the protein that is less soluble and more resistant to enzyme degradation than the normal form. Two other theories are the virus and virino theories.
From 1986 to 1998, an estimated 171,000 head of cattle were diagnosed with BSE in Great Britain. The epidemic may have resulted from the feeding of scrapie-containing sheep meat-and-bone meal to cattle, but most likely was amplified by feeding rendered bovine meat-and-bone meal back to cattle. Several other European countries have reported indigenous cases of BSE. No cases of BSE have been diagnosed in the United States. The USDA BSE Working Group has taken aggressive measures to prevent BSE from entering the U.S. over the last 10 years. These measures include the 1989 ban of cattle and cattle products from countries where BSE has been reported and active inspection, testing, and education programs targeted toward preventing the entry of suspect animals and animal products into this country. USDA cooperates with other government agencies in carrying out this mission. The information developed through the risk analysis will be used to refine USDA's regulatory activities.
Done in Washington, DC, on September 11, 1998. Thomas J. Billy, Administrator.
webmaster opinion 22 Sept 98The defective retrovirus, intracisternal A-particle or IAP, in mouse is some 6,593 bp long and located midway between exon 2 and exon 3 , with long terminal repeats (LTRs) occupying the first and last 82 bp. Mus musculus short incubation prion protein Prnpa has accession number U29186.
IAPs are all over the mouse genome, 750 Blastn hits to this one, plus some variants in hamsters and human. However, it is not found in prion genes of other species so far studied; hamster, rat, cow, sheep, and humans in particular have been sequenced in this region and are negative. It affects the 'a' strains of mice, not the 'b'.
Since there is a a 217 bp deletion in the reverse transcriptase gene and various stop codon problems, the IAP is defective, a somewhat moot point since all of the genes are on the wrong strand, ie transcription of mouse prion produces complementary mRNA (that is further spliced out of translational substrate). Still there is some potential for complementation by other IAPs and scenarios whereby hypothetical excision or integration has a modulating effect on prion protein production.
Given the passions of viral proponents, there is also potential for serious confusion or outright misrepresentation because IAPs have come up twice before in TSEs. An IAP sequence surface as an up-regulated message in scrapie-infected mouse neuroblastomas. This IAP turned out to have a sequence not closely related to the IAP embedded in the prion gene. Secondly, IAPs reported by the Manuelidis group are in hamster (which lacks the prion IAP) and are consistent with simple contamination by a very abundant set of transposable elements.
It is safe to say there is no data supporting any role of the embedded IAP in TSEs at this point, though one wonders if the extra 6,593 bases, despite being spliced out, can be wholly neutral in regards to differences between 'a' and 'b' strains of mice.
webmaster comment 16 Sept 98A 3' UTR mariner element is found in sheep, annotated unobtrusively as 'Oamar1'. It is fair to say the mariner element also occurs in cows at 3' UTR positions 2814-4039 of AB001468 (probability 1.8e-145) but not in human or mouse. (This note is oddly the first announcement of bovine mariner.) Humans do have quite a few mariner elements, just not any within the prion gene.
Both sheep and cow mariner elements have numerous frame shifts in all registers so the transposases are inactive. Which is not to say that the mariner elements are inactive -- they could borrow a transposase from elsewhere in the genome. There is more to life than ARQ alleles in the ORF -- the worry with mariner elements is that they will move the sheep prion gene into an over-producing setting, possibly somatically.
Sheep U67922 , M31313, and AJ223072 differ slightly in their mariner element sequences, indicating sequencing error in the latter two, as noted by Lee. Mariner elements were originally associated with insects; curiously Chrysops vittatus (deer fly) is the closest (weak) match to sheep and cow, consistent with horizontal gene transfer in a common ancestor. CWD mule deer and elk have not been sequenced in this region (and are 'upstream' of cow-sheep in the family tree) so they may or may not have this mariner element.
For everyone's convenience:
>sheep_mariner U67922 position 24889-26108 (transposase 25050-26030 approx, ITRs at ends) ctgggtcggctaaaaggttcattaggttttttttctgtaagatggctctagtagtacttgtctttatcttcattcgaaacaattttgttagattgtatgtgacagctcttgtatcagcatgcatttgaaaaaaacatcaaaattggtaaatttttgtatagccatcttactattgaagatggaagaaaagaagcaaaattttcagcatatcatgctgtattatttcaagaaagataaccaaaatgcaaaaatgtatttgtgaagtgtatggagaaggggctgcaactgatcaagcttgtcaaagtagtttgtgaagtttcgtgctggagatttcttattggacgatgctccacagttggatataccagttgaagttgatagtgatcaaattgagatattgagaataatcgatgttataccacgcgggagatagctgacatactcaaaatatccaaatagaaccttgaaaaccatttgcaccatctcagttatgttaatcactttgatgtttgagttccacataagcaaaaaaacaacaacaacaaaaaaaaacacaaccttgaccatatttgcgcatgcagttctctactgaaatgattgaaaacactttgtttttaaaaacagattttgattaacagtgggtacgatacaataacgtagaatggaagaaattgtagggtgagcaaaatgaaccaccaccaccaaaggccagtcttcctctaaagaagatgtgtgtatggtgggattggaaagtaatcctctattatgaattcttctggaaaacactgctcctaattagaccaactgaaagcagcactcaacgaaaagcatccagaattagtcaatagaaaacataatcttccatcaggataacgcaagactacatatttctttgatgacccagcatggctggagtttctgattcatctgttgtattcagacgttgcatctttggattttttccatttatttcagtctacaaaattatcataatggaaaaaatttccattccctggaagattgtaaagtgcatctggaaaatttctttgctcaaaaagataaaaagttttgtgaacacagaattatgacgttgcctgaaaaatggcagaaggtagtggaacaaaagagtgactatgttgtttggtaaagttcttagtgaaaatgaaaaatgtgtcttttatttttatttaaacaccaaaggcacattttggccaacccaa
How 3' UTR sheep U67922 was annotated at GenBank entry: 26295 is end of mRNA (but not of sequence)
.........VILFSSPPVILLISFLIFLIVG"
repeat_region 23801..24187
/rpt_family="Bov-B"
repeat_region 24709..24867
/rpt_family="Bov-tA3"
*repeat_region 24889..26108
/rpt_family="Oamar1"
>bovine mariner AB001468 positions 2814-4039 78% identities probability 1.8e-145 mariner overlooked
ctgggttggctaaaaggttcattaggttttttttctgtaagatggctgtctttaacttcattcgaaacaattttgttagattgtatgtgacagctcttgtatcagcatgcatttgaaaaagaaaacaacttaccaaaattggtgaatttttgtatagccattttactattgaagatggaagaaaagaagcaaaattttcagcatatcatgctgtattatttcaagaaagataacacaaccaaaatgcgaaaatgtatttgtgcagtgtatggagaaggtgctgcaactgatcaagcttgtcaaagtagtttgtgaagtattgtgctggagatttcttactggacaatgctccacagtcgggtataccagttgaagttgatagtgatcaaattgagatattgagaacaatcaatgttataccacgtgggagatagctgacatactcaaaatatccaaatagaaccttgaaaaccatttgcaccatctcagttatgttaataactttgatgtttgagttccacataaattaagcaaaaaaaaaacaaaaacaaaaacacacaaccttgaccatatttgcatatgcagttctctactgaaatgaatgaaaacacttttgtttttaaaaacagattttgatgaacagtggatactatacaataacgtagaatggaaaagactgtggggtgagcaaaatgaaccagcaccaccaaaggccaggcttcatccaaagaagatgtgtgtatggtgggattggaaagtaatcctctattatgggattcttctggaaaaccaaaaaatcaattccaacaagtactgctcctaattagaccaactgaaagcagcattcaatgaaaagcatccagaattagtcaatagaaagcatataatcttccatcaggataacacaagactacatttctttgatgacccagcatggctgagaggttctgattcacctgctgtattcagacattgcatctttggatttccatttatttcagtctacagaattatcatcatgaaaaaaatttccattccctggaagattgtaaagtgcatctggaaaacttctttgctcaaaaagataaaaagttttgtgaacacagaattatgaagttgcctgaaaaacagcagaagatagtgactatgttgttcagtaaagttcttggtgcaaatgtgtcttttatttttatttaaacactaaaggcacgttttggccaacccaa
Summary of news clips 15 Sept 98The fortuitous appendectomy in September 1995, eight months before the victim signs of nv-CJD [numbness in face and right hand in May 1996] and 33 months before death in June 1998, presents an opportunity to determine the scope of the epidemic. Samples from the yearly 44,000 appendectomies and 800,000 tonsillectomies are kept by hospital laboratories; samples go back to 1920 in some cases. Once again we are reminded of AIDS.
We do not know how much earlier than eight months rogue prion can be detected, whether it is a reliable predictor of if and when a person will develop nvCJD, or whether it is necessarily indicative of nvCJD as sometimes claimed. While it is a miracle to have time samples so far back and so many at no cost in the present, the test procedure does not seem automatable nor quantitative and the numbers discussed (1000's) sound inadequate, especially if the incubation time is decades. If positives are found, then it becomes a matter of tracking them for some years. Will there positives from the 1945-1975 era?
Press snippets:
"Dr James Ironside, from the National CJD Surveillance Unit in Edinburgh, said the number of specimens to be checked would run into thousands. Many will have been removed some time before the mad cow scare began, possibly back in the 1970s. "We are taking advice from the London School of Hygiene and Tropical Medicine as to how many specimens we need to examine," said Dr Ironside. The findings would be collated, assessed and published, he said.... Dr Dealler said: "We have all eaten, on average, 50 meals of meat from infected cattle."
Chemistry and Industry, 18th September, p726 C&I e-mail European patent application 0861900Prion diseases - degenerative diseases of the central nervous system, including bovine spongiform encepalopathy (BSE) and Creutzfeld-Jakob disease (CJD) - have become a major health conern over the past two decades. They have long incubation periods, produce no obvious immune response and are inevitably fatal.
Diagnosis of the disease still depends on the appearance of clinical symptoms. Detecting the infection at an earlier stage would depend on identifying a disease-specific protein, or "prion" protein, that appears in the nervous system long before clinical signs show.
Carsten North and colleages at Zurich's agricultural management institute say that have now developed a method of diagnosising prion diseases which, if developed 15 years earlier, could have prevented BSE-infected meat entering the human food chain.
The researchers inoculated laboratory mice with a highly purified prion protein, then fused cells from the spleens of the mice with certain tumour cells. The resulting hybrid cells made large quantities of highly specific antibodies to prion proteins, The team then used these antibodies to develop tests for the proteins. Preparations based on these antibodies may also help treat and prevent prion diseases, the researchers claim.
Transfusion 1998 Sep;38(9):810-816 Brown P, Rohwer RG, Dunstan BC, MacAuley C, Gajdusek DC, Drohan WNThe administration of blood components from donors who subsequently develop Creutzfeldt-Jakob disease has raised the issue of blood as a possible vehicle for iatrogenic disease. STUDY DESIGN AND METHODS: We examined infectivity in blood components and Cohn plasma fractions in normal human blood that had been "spiked" with trypsinized cells from a scrapie-infected hamster brain, and in blood of clinically ill mice that had been inoculated with a mouse-adapted strain of human transmissible spongiform encephalopathy. Infectivity was assayed by intracerebral inoculation of the blood specimens into healthy animals. Most of the infectivity in spiked human blood was associated with cellular blood components; the smaller amount present in plasma, when fractionated, was found mainly in cryoprecipitate (the source of factor VIII) and fraction I+II+III (the source of fibrinogen and immunoglobulin); almost none was recovered in fraction IV (the source of vitamin-K-dependent proteins) and fraction V (the source of albumin). Mice infected with the human strain of spongiform encephalopathy had very low levels of endogenous infectivity in buffy coat, plasma, cryoprecipitate, and fraction I+II+III, and no detectable infectivity in fractions IV or V. Convergent results from exogenous spiking and endogenous infectivity experiments, in which decreasing levels of infectivity occurred in cellular blood components, plasma, and plasma fractions, suggest a potential but minimal risk of acquiring Creutzfeldt-Jakob disease from the administration of human plasma protein concentrates.
Transfusion 1998 Sep;38(9):817-820 Evatt B, Austin H, Barnhart E, Schonberger L, Sharer L, Jones R, DeArmond SAlthough Creutzfeldt-Jakob disease (CJD) has been shown to be transmissible through blood components in rodent models, no human blood-to-blood transmission has been documented. If blood transmission were possible in humans, persons with hemophilia in the United States would be at higher risk of contracting CJD, because they receive large numbers of blood components. Nearly one-half of the hemophilia population contracted HIV in the 1980s, and many of these people have since died with neurologic complications. This study investigated whether some hemophilia patients with neurologic disorders may have died with CJD.
Hemophilia treatment Centers across the United States were invited to participate in this retrospective surveillance study. The centers were asked to send any available formalin-fixed paraffin block brain samples from hemophilia decedents. Slides were prepared at the Centers for Disease Control and Prevention and reviewed by three expert neuropathologists. Two slides were stained for the prion protein at the request of one of the neuropathologists. Specimens from 24 decedents with genetic bleeding disorders were collected and reviewed.The panel found no evidence of CJD in any of the specimens. Although the study sample is small, these results support the growing evidence that CJD is not being transmitted in the nation's blood supply.
Comment (webmaster): The numbers involved in this study are far too low to have any signficance. Not a single case would be expected from 24 decedents even if the rate of CJD was 1 per hundred, a 10,000 excess. Given the long incubation period of CJD and low titres expected in blood, the study is basically looking at blood risk in 1975, a moot issue for policy today, and says nothing about contemporary risk. Recent intensive agricultural practises and recent strains such as nvCJD, to which large numbers of American servicemen and women were exposed in the late 1980's, deserve better. Look-back methods compare very poorly to immunmological methods that directly examine contemporary blood products for infectious agent.
The neurological complications were a direct consequence of the AIDS virus, not of dementia, so they mistakenly selected a lower-risk younger group to study. It would make better scientific sense to consider older decedents that did not have AIDS but did have 'Alzheimer' and similar disorders. In a study this expensive, the extra cost of doing immunohistochemistry on all decedents is negligible and makes more sense than doing just two slides.
"Growing evidence that CJD is not being transmitted in the nation's blood supply" is an irresponsible statement. The Canadian government has reviewed the same data and come to a very different conclusion. The truth is, there is no good data one way or another. Surely the authors don't consider the above study of Brown et al. as supporting their position, yet this is the best and most recent paper on ths subject. And they were at the meetings where it was discussed well in advance of publication.
In short, the CDC is at it again: no real science, simply a Beltway political agenda to provide support for the controversial new policy not to recall bad blood. Their previous foray into CJD was similar -- a widely ridiculed effort geared at establishing a low base line for CJD incidence by polling neurologists. One only has to look at the real -life experiences of a set of 100 patient families with real-life neurologists to learn how silly that experimental design was.
The CDC has repeatedly declined to get involved in the key issue: the proportions of Alzheimer diagnoses which are actually CJD. One of the authors of this study had the nerve to tell the webmaster in December 1996 that they had never heard of such a case and didn't want to hear about one now! The literature of course is full of them but the CDC representative had never heard of Medline.
Yet the CDC portrays itself to Congress as needing a ton of money to support its "fight" against mad cow disease, 30 times what real working scientists are getting. This web sites opposes this as a total misallocation of funds:
By RUSS BYNUM Associated Press Writer September 11ATLANTA (AP) ã Federal health officials hope the emergence of new diseases and drug-resistant germs will persuade Congress to approve $200 million to help fight the problem. The Centers for Disease Control and Prevention wants the money to beef up programs started in 1994 to identify new illnesses and resilient old killers before they're able to spread undetected.
Now the CDC is asking for more than three times the $59 million it has received for the project over the last four years. Officials say the amount is justified by recent outbreaks of illnesses such as Asian bird flu and mad-cow disease.
Neurology 1998 Sep;51(3):734-737 Berr C, Richard F, Dufouil C, Amant C, Alperovitch A, Amouyel PBACKGROUND: Little is known about the role of the prion protein (PrP(sen)/gene PRNP). PRNP knockout mice studies suggest that PrP(sen) may be involved in CNS degeneration. This observation prompted us to examine the influence of PRNP genetic variability on cognitive abilities in the elderly. METHODS: In a community-based sample of 1,163 subjects aged 59 to 71 years, we characterized the valine (Val) and methionine (Met) allele of the PRNP polymorphism at codon 129. The effect of this polymorphism was estimated on the Mini-Mental State Examination (MMSE) and on a global composite score built from a battery of nine different neuropsychological tests. The results were adjusted for age, gender, education, and apolipoprotein E (apoE) polymorphism. RESULTS: Cognitive impairment (MMSE score < 24) was present in 2.5% of the Met-Met individuals, 2.9% of the Met-Val individuals, and 7.0% of Val-Val subjects (p = 0.02). Subjects homozygous for the PRNP Val allele had a lower MMSE and global score than the two other genotypes (p < 0.003). This effect was of the same magnitude as that of the apoE epsilon4 allele on cognitive performances. Both apoE epsilon4 and PRNP Val allelic effects were additive. CONCLUSION: This observation suggests that variability of the PRNP locus may be associated with cognitive performance in the elderly. This result, if confirmed, offers potential clues for the role of PRNP in the human brain.
J Biol Chem 1998 Oct 2;273(40):25545-25547 McKenzie D, Bartz J, Mirwald J, Olander D, Marsh R, Aiken JThe only known difference between the cellular (PrPC) and scrapie-specific (PrPSc) isoforms of the prion protein is conformational. Because disruption of PrPSc structure decreases scrapie infectivity, restoration of the disease-specific conformation should restore infectivity. In this study, disruption of PrPSc (as monitored by the loss of proteinase K resistance) by guanidine hydrochloride (GdnHCl) resulted in decreased infectivity. Upon dilution of the GdnHCl, protease resistance of PrP was restored and infectivity was regained. The addition of copper facilitated restoration of both infectivity and protease resistance of PrP in a subset of samples that did not renature by the simple dilution of the GdnHCl. These data demonstrate that loss of scrapie infectivity can be a reversible process and that copper can enhance this restoration of proteinase K resistance and infectivity.
24 Sep 98 Science Laura Manuelidis"Nigel Williams (Science, News of the Week, 4 Sept., p. 1422) notes several critical concerns about the spread of epidemic Creutzfeldt-Jakob disease (CJD) involving surgery and infected peripheral tissues. In concluding, he cites potential transmissions from CJD-contaminated instruments, with the mandate that decontamination procedures for surgical instruments should be further assessed. Because of similar concerns, several years ago we identified a commercially available solution (with GdnSCN) that does not corrode fine stainless steel instruments. When instruments were exposed to this solution, CJD infectivity was reduced more than 100,000-fold in crude tissue (.L. Manuelidis, J. Neurovirol. 3, 62 (1997)), and none of the intracerebrally inoculated animals developed symptoms or lesions during 2 years of observation. This established procedure may be useful as a general and inexpensive method to reduce the inadvertent risk of CJD (or bovine spongiform encephalopathy abbatoire) transmission before test results from biopsy specimens can be analyzed."
[Guanidinium thiocyanate (GdnSCN) is a mild protein denaturant somewhat like urea. GdnSCN is an abbreviation used only in prionology. Altogether, there are 8 earlier medline papers, (plus many dozen more, including a new posthumous paper by RF Marsh, that use guanidinium hydrochloride) -- webmaster]
Madec JY, et al.
Biochemical properties of protease resistant prion protein PrPsc in natural sheep scrapie.
Arch Virol. 1997; 142(8): 1603-1612.
Manuelidis L.
Decontamination of Creutzfeldt-Jakob disease and other transmissible agents.
J Neurovirol. 1997 Feb; 3(1): 62-65.
Dron M, et al.
Visualization of viral candidate cDNAs in infectious brain fractions from CJD by representational difference analysis.
J Neurovirol. 1996 Aug; 2(4): 240-248.
Oesch B, et al.
Properties of the scrapie prion protein: quantitative analysis of protease resistance.
Biochemistry. 1994 May 17; 33(19): 5926-5931.
Serban D, et al.
Rapid detection of Creutzfeldt-Jakob disease and scrapie prion proteins.
Neurology. 1990 Jan; 40(1): 110-117.
Caspi S, et al.
The anti-prion activity of Congo red. Putative mechanism.
J Biol Chem. 1998 Feb 6; 273(6): 3484-3489.
Peretz D, et al.
A conformational transition at the N terminus of the prion protein features in formation of the scrapie isoform.
J Mol Biol. 1997 Oct 31; 273(3): 614-622.
McKinley MP, et al.
Ultrastructural localization of scrapie prion proteins in cytoplasmic vesicles of infected cultured cells.
Lab Invest. 1991 Dec; 65(6): 622-630.
22 Sep 98 medline and correspondence[It seems there are two distinct groups in Italy doing chromsomal and synteny work on the prion gene. The other group reports [see below] OAR13q15 for sheep, not OA 13q17/q18. It would be of considerable value to sequence the river buffalo prion gene. --webmaster]
Comparative mapping of the prion gene (PRNP) locus in cattle, sheep and human with PCR-generated probes.
Mamm Genome. 1998 Oct; 9(10): 853-855. Castiglioni B, Comincini S, Drisaldi B, Motta T, Ferretti L"In an article that will appear soon on the journal "Mammalian Genome" entitled "Comparative mapping of the prion gene (PRNP) locus in cattle, sheep and man with PCR-generated probes" the authors (Castiglioni B, Comincini S, Drisaldi B, Motta T and Ferretti L) belonging to the IDVGA-CNR of Milan, Italy have determinated the following chromosomal localization of the bovine prion locus: BTA 13q17. Furthermore, they made comparative mapping of the prion gene in three different species (bovine, ovine and human) by means of fluorescence in situ hybridization (FISH) with the human coding region probe. The chromosomal localizations (BTA 13q17, OA 13q17/q18 and HSA 20p12/p13) were in agreement with the available comparative maps of the species."
Correspondence to Sergio Comincini Ph.D. IDVGA-CNR via F. Cervi 93 20090 Segrate, Milano (Italy) tel + 39 2 21013524 fax + 39 2 23412135
Iannuzzi L, Palomba R, Di Meo GP, Perucatti A, Ferrara L Cytogenet Cell Genet 1998;81(3-4):202-204 National Research Council (CNR), I.A.B.B.A.M., Naples (Italy)Comparative FISH-mapping of the prion protein gene (PRNP) was performed on cattle (BTA), river buffalo (BBU), sheep (OAR) and goat (CHI) chromosomes using a PCR-product as a probe and R-banding. PRNP was mapped to BTA13q17, BBU14q15, OAR13q15 and CHI13q15 according to standard nomenclatures. These chromosomes and bands were homoeologous among the four species, confirming the high degree of gene and chromosome banding conservation among bovids. Furthermore, the assignment of PRNP to river buffalo and goat chromosomes allowed us to indirectly assign the bovine syntenic group U11 to specific chromosomes, since it is the first in situ localization on BBU14 and CHI13.