Is scrapie solely a genetic disease?
High risk sheep alleles for scrapie in Scotland, US
Ovine scrapie susceptibilityin US
Question and Answer clarification by the authors
Vet Rec 140 (3): 59-63 (1997) Hunter N, Moore L, Hosie BD, Dingwall WS, Greig AThe incidence of natural scrapie in sheep is associated with polymorphisms of the PrP gene, particularly those at codons 136, 154 and 171. In many breeds, the PrP allele encoding valine at codon 136 confers an extremely high risk of scrapie, but in Suffolk sheep this allele is vanishingly rare. In this study of a single closed flock of Suffolk sheep in Scotland, scrapie occurred primarily in animals which were homozygous for glutamine at codon 171, a genotype which was significantly less frequent in healthy flockmates. However, the apparent linkage between glutamine at codon 171 and scrapie was not completely recessive because two of 64 scrapie cases were heterozygous glutamine/arginine. These results suggest that breeding for increased resistance to scrapie in Suffolks by the selection of animals according to their PrP genotype is a feasible option.
See also J Gen Virol 77 ( Pt 11): 2885-2891 (1996) for the situation with goat alleles.
J Gen Virol 78 ( Pt 4): 975-978 (Apr 1997) O'Rourke KI, Holyoak GR, ... Besser TE, Foote WC USDA, Agricultural Research Service, Washington State University, Pullman 99164-7030, USA.One-hundred and three Unites States Suffolk sheep were inoculated orally with a scrapie agent preparation and monitored for clinical disease and histopathological lesions characteristic of scrapie. A retrospective study of the polymorphisms at codon 171 of the prion protein (PrP) gene was performed on these sheep.
All 63 sheep that developed scrapie during the observation period were homozygous for the glutamine 171 (171-QQ) PrP allele. Twelve 171-QQ sheep failed to develop disease. All 5 sheep homozygous for arginine (171-RR) and all 23 heterozygous (171-QR) sheep remained free of scrapie.
[One question here is what was the genotype of the sheep providing the scrapie agent consumed by the other sheep. This is important because it affects the 'species barrier' under test, ie, the differences between the rogue and normal prion monomer making up the heterodimer that recruits normal to abnormal. Ath the least, it makes studies difficult to compare to one another.-- webmaster]
Nature 13 March 1997 Vol. 386, No.6621 page 137 (Scientific Correspondence) N Hunter, D Cairns, J D Foster, G Smith, W Goldmann & K DonnellyThe article seeks to understand whether the lack of reported scrapie in countries outside of the Uk is due to the absence of hish-risk scrapie alleles or due to the absence [or presence] of some other factor. Sheep have 13 haplotypes in the trimorphic region of codon 136-171. The authors find that alleles with high susceptibility to scrapie are indeed present in Australia and New Zealand yet scrapie is not being reported, supporting the idea of other factors.
Scrapie is an interesting problem in genetics, with a need to distinuish between a polymorphism predisposing to but not sufficient for disease, from a recessive disease-causing mutation with poor penetrance. Clean cases of genetic-TSE in sheep and goat have not been seen and the origin of the disease in these animals remains unclear, though certain alleles can markedly affect susceptibility and age of onset.
Correspondence between the webmaster and Dr. Nora Hunter:
1. How were the New Zealand- Australian [NZA] sheep selected? That is, to what extent were they representative of the overall populations of these breeds in NZA? Sometimes a single ram is used to tup an entire herd, distorting gene frequencies.
The sheep were not selected to be representative of NZA breeds and are, in fact not so. Cheviots and Suffolks were chosen because we understand the genotypes of these breeds which are susceptible to scrapie in the UK, US etc. We needed to have these breeds because if we had chosen, for example Merinos or Corriedales, we would have no idea of the significance of any findings because we don't know the genotypes in these breeds which might be susceptible to scrapie. The project asked one simple question - do PrP genotypes known to be scrapie susceptible in the UK exist in scrapie free countries.
2. It seems that the full ORF was not sequenced [except for the two special Australian sheep], so evidently there was a restriction fragment spanning codons 136-171. How large was this, and how did you exclude other polymorphisms in unsequenced coding regions in the NZA sheep?
The full ORF was not sequenced except for the two sheep of the most susceptible genotype known - the two Aus sheep. The genotyping is done by a mixture of methods all involving PCR of about 400 BP of PrP gene DNA. The non-sequenced parts of the PrP gene are not relevant except in those two Aus animals of the most susceptible genotype. These susceptibilities are well established in sheep from many countries and the V136 homozygote is considered to have a death sentence by several sheep genetics groups. This was the only one that there was any point in fully sequencing. We do, however have further information about other animals with no unexpected findings.
3. In quite a few species, polymorphisms are known in upstream non-coding regions. Collinge has suggested that a distal change in non-coding intron 2 might be important to CJD. Over-production of mouse prion protein seems to have a role in susceptibility. If only the ORF was sequenced in the two Australian sheep with high-risk genotype, how did you exclude promoter down-mutations and the like in the Australian sheep? With restricted imports, a strong "founder effect" on allele frequencies is possible in specific sheep populations.
I agree that there may be other mutations in other regions of the gene which are important and indeed my group and others are working on just this point. However the question in the paper related solely to the described polymorphisms and the point was only to establish their importance or other wise. I was very careful to limit my remarks to the PrP protein coding sequence. Many other groups consider this is enough to cause disease in mutant genotypes in humans (the 102 mutation and GSS, for example) and there has been strong feeling that the same was true for sheep. The only "mutation" with any chance at all of being a "genetic disease" is the V136. That is therefore the only one I was really concerned with in this paper.
4. Was the 96 month old Australian sheep with the high-risk genotype immuno-stained? More generally, how many sheep with neurological disorders are examined annually in ANZ by modern techniques? Gibbs predicts familial-OSE (ovine spongiform encehphalopathy) at the one per million level, implying that OSE cannot be bred out of sheep, that there are no OSE-free countries, and OSE cannot be eradicated. . The UK scrapie strains considered here may eventually be a small part of the overall OSE picture -- and other forms of OSE might be more easily transmissible to humans.
The 96 month sheep was not immunostained as we did not have access to the animal. It was difficult enough to get the blood sample. We have no evidence either way to support your contention that familial scrapie occurs at 1 in a million. In which genotypes? The best evidence for genetic disease is in the V136 sheep, homozygotes are less than 1% usually, but not that rare. I don't know the incidence of scrapie in the UK as it has all but disappeared since the EU made the disease notifiable with associated trading penalties for those declaring scrapie.
5. 4. Both countries have made a very sincere effort to keep scrapie out and have spared no expense. New Zealand has an enormous economic stake in sheep-derived pharmaceuticals. Many countries in Europe are suspected of under-reporting BSE, as per statistical expectations. The status of scrapie in these countries has not been verified by non-economically conflicted parties.
Do you plan to import high-risk sheep from ANZ to England and place in scrapie flocks to see if they acquire the disease? This could be done with twin lambs. A positive result here with good controls might strengthen the conclusion that other factors were necessary beyond the high-risk allele.
We do have plans to import sheep to the UK.
6. A back of the envelope calculation: The highest risk genotype for UK scrapie, the V136 homozygote, was found in 2 Australian Cheviots of the 54 examined. Cheviots are a minor breed (1.5 million) for Australia, merinos being 90% of the 120,000,000 sheep. If the sheep sequenced were representative of Cheviots, then 30,000 Cheviots in Australia might have this genotype. The Australian authorities examined 2,438 sheep brains in 1991 through 1995, using no immunochemistry, and reported no scrapie. By proportion, only 36 of these would have been Cheviots and so 1 of these might have had the high risk genotype, or 5 over 25 years of in-house testing, some of them perhaps quite young and none with modern methods.
I would conclude from this that we don't know a whole lot about the incidence of scrapie in Australian Cheviots. The Australian track record, on disclosure of CJD contamination of pGH , shows an absolutely appalling contempt for medical ethics and human life, so why expect anything better for OSE reporting? As you noted, they didn't have any great enthusiasm for your blood sampling.
Gibbs suggests that genetic TSE at a one per million rate should be the default assumption in basically all mammals. The argument uses CJD familial incidence, the high convervation of the sequence, and the observation that the situation isn't any different from a hemoglobinopathy or any other genetic disorder. The mutation rate in mammals [60 per cell division] is enough to hit every nucleotide in a 750bp gene in every generation when there are 100,000,000 animals of that species around. I have written this up the molecular biology of this at great length.
Thus Australia is expected to have 120 cases of OSE a year. Just as CJD only rarely presents with pruritus, these 120 wouldn't necesarily resemble clinical UK scrapie. And they might well have high infectious titre, but no manifest neurological symptoms at all, and end up in a pooled medical product. Fine, they are using best-management-practises, and for now the risk cannot be reduced below this. But that risk needs to be acknowledged and disclosed.
K. I. O¼Rourke, R. P. Melco and J. R. Mickelson USDA, ARS, ADRU 337 Bustad Hall, Washington State University Pullman, WA 99164The allelic frequencies of an ovine gene associated with susceptibility to scrapie was analyzed in a sample of 30 scrapie affected sheep and 545 clinically normal sheep from 12 flocks. The allele encoding glutamine at codon 171 occurred at a frequency of 0.76 in the overall population. All 30 scrapie affected sheep were homozygous for glutamine at codon 171. This genotype was observed in 56.5% of the clinically normal sheep. None of the 30 scrapie affected sheep carried the allele encoding Valine at codon 136 although this allele was observed in 2/12 flocks sampled.
Scrapie is a transmissible neurodegenerative disease of sheep and goats. The occurrence of scrapie in the U.S. results in moderate direct losses to producers. However, significant indirect losses occur due to limitations on certain export markets, reduced availability of rendering facilities for culled animals, and depopulation of lamb crops following a scrapie diagnosis in the flock. Disease signs do not typically appear until age three and no ante-mortem diagnostic test is yet available.
Scrapie and the related transmissible spongiform encephalopathies of humans, cattle, mink, and deer are all characterized by deposition of abnormal fibrils, consisting largely of a proteinase-resistant isomer of a host protein known as the prion protein (Bolton, 1982; Merz, 1984). The prion protein (PrP-cellular or PrP-c) is a sialoglycoprotein produced primarily in the central nervous system and at lower levels in numerous other tissues (Horiuchi, 1995). The scrapie isoform (PrP-Sc) accumulates in nervous tissue and the lymphoreticular system of affected sheep (Ikegami, 1991; Miller, 1993).
PrP-Sc copurifies with infectivity and may represent the disease inducing agent, acting as a template for conversion of PrP-c to PrP-Sc through a nucleation or refolding process (Gajdusek, 1993; Prusiner, 1991; Come, 1993). In well-described rodent models, the pattern of disease susceptibility, incubation time, and neuropathology varies, depending on the primary sequence of the host prion protein and the scrapie strain used as an inoculum (Westaway, 1987, Carlson, 1994). Homology at one or several critical amino acid residues increases the efficiency of the conversion of the host PrP-c by the template PrP-Sc (Priola, 1995) and determines the biochemical characteristics of the resulting PrP-Sc (Carlson 1994, Bessen 1992). Heterologous residues at those sites prevent the accumulation of PrP-Sc molecules in vitro (Priola, 1994) and may delay or prevent disease in vivo.
The ovine PrP-c gene has 4 known polymorphic sites, encoding amino acid changes at codons 112 (M or T), 136 (A or V), 154 (A or H) and 171 (Q, R, or H) (Belt, 1995; Goldmann, 1990). Two ovine scrapie strains (strain A and strain C) have been defined by their differing effects in genetically defined Cheviot sheep (Goldmann, 1994a, 1994b). Sheep of several breeds are highly susceptible to natural scrapie and to experimental challenge with strain A scrapie if they are homozygous or heterozygous for V-136. In other breeds, including Suffolks, sheep homozygous for Q-171 are highly susceptible to natural scrapie and to experimental exposure to scrapie strain C (Goldmann, 1994a, Goldmann, 1994b, Hunter, 1993, Hunter, 1994, Maciulus, 1992, Westaway, 1994). Therefore, selection of rams to increase the frequency of the AA-136, RR-171 or AA-136, QR-171 genotypes has been proposed as a control measure to reduce the incidence of ovine scrapie (Belt, 1995; Westaway, 1994).
In this study, we determined the PrP-c genotypes of a sample of 30 naturally affected Suffolk sheep from 26 flocks of origin and the allelic frequency and genetic fitness of the PrP-c alleles encoding Q, R, and H at codon 171 in a sample of 545 clinically normal Suffolk sheep from 12 flocks. We also report that the allele encoding valine at codon 136 was found in 2 of the 12 flocks of Suffolk sheep.
Tissues or EDTA-treated blood samples from scrapie-affected sheep were submitted by private and government veterinarians, or from the National Veterinary Services Laboratories (NVSL), Ames, Iowa. Diagnosis was made by histologic and/or immunohistologic examination of formalin fixed brain tissue by pathologists at NVSL. Samples were also collected from 12 flocks of registered Suffolk sheep (see Table 1). Three types of flocks are represented in this study. Samples from Flocks 1, 2 and 3 included progeny of scrapie positive ewes and other high risk animals.. Flocks 4 and 5 were sampled after removal of scrapie-affected animals, their progeny, and all sheep designated as „high-risk¾ according to APHIS regulations. Flocks 6 through 12 had no diagnosed cases of scrapie during the preceding 12 months. The number of animals per flock ranged from 11 to 152. Samples were collected from all animals in each flock, although some samples were not usable due to DNA degradation during transport or storage. Genotype analysis was performed on 545 sheep. DNA was isolated from EDTA-treated blood samples or from frozen samples of brain or spleen using a commercially available kit (Gentra Systems) following the manufacturer¼s recommendations except that the samples were rehydrated in sterile water rather than Tris-EDTA. Genomic DNA was amplified with one of two primer pairs.
Primer 1: 5¼ GGCATTTGATGCTGACACC Primer 2: 5¼ ACTACAGGGCTGCAGGTAGAC Primer 5a: 5¼ AAGGTGGTAGCCACAGTCAGTGGA Primer 6: 5¼ TCTCTCTGGTACTGGGTGATGCACPrimers 1 and 2 amplify the entire PrP-c open reading frame (Westaway, 1994). PCR conditions were 50 mM KCl, 10 mM Tris, pH 8.3, 1.5 mM MgCl2, 10 pmol each primer, 0.2 mM dNTPs in a volume of 100 ul. Following a hot start at 95ÉC for 5 minutes, 0.5 U Taq polymerase (Perkin Elmer) was added at 80ÉC, followed by 35 cycles of 56ÉC for 60 sec, 72ÉC for 60 sec, 94ÉC for 45 seconds. Primers 5a and 6 amplify the region between base pairs 358 and 742 of the PrP-c gene (Westaway, 1994). Amplification conditions for primers 5a and 6 were 10 mM Tris-HCl, pH 8.3, 1.5 mM MgCl2, 20 pmol each primer, 1 ug genomic DNA, 0.5 U Taq polymerase for 35 cycles of 94ÉC for 5 minutes, followed by 30 cycles of 95ÉC for 15 seconds, 60ÉC for 15 seconds, 72ÉC for 10 seconds and a 7 minute 72ÉC extension. Products were analyzed on ethidium bromide stained 2% agarose gels. DNA was extracted from replicate, independently collected blood samples of 55 sheep, amplified using either primers 1 and 2 or 5a and 6, and analyzed for codon 136 and 171 polymorphisms. Identical results were obtained with each pair of samples.
DNA sequence analysis was performed on all samples from scrapie-affected sheep. DNA was amplified with primers 5a and 6 and the PCR product was sequenced by an automated dideoxy chain termination method at the Molecular Genetics Facility, University of Georgia, Athens, GA. Samples from clinically normal sheep were tested for PrP-c codons 136 and 171. Codon 136 was analyzed by digestion of PCR products with BspHI and agarose gel electrophoresis as described (Hunter, 1991).PrP-c codon 171 alleles were distinguished by allele-specific oligonucleotide hybridization (Westaway, 1994). For each allele, 5 ul of PCR product was diluted with 200 ul of 0.3 M NaOH, 30 mM EDTA and denatured at 95C for 2 min, then placed on ice. This DNA was applied to a Zeta Probe nylon membrane in a slot blot apparatus. The wells were washed with 400 ul 20X SSPE and the DNA immobilized by UV-crosslinking. The hybridization solution contained 6X SSC, 1X Denhardt¼s solution, 0.1% SDS and 10 pmol 32P-labelled oligonucleotide probe, end-labelled with [gamma 32 P]ATP by polynucleotide kinase. The allele specific probes were 5¼-GTGGATCGGTATAGT for the R allele, 5¼-GTGGATCAGTATAGT for the Q allele, and 5¼-GTGGATCATTATAGT for the H allele. The filters were hybridized at 45ÉC for 16 hours, then washed in 6X SSC, 0.1% SDS at 50ÉC for 20 minutes and exposed to X-ray film for detection.
DNA samples from 30 scrapie affected sheep were sequenced to determine the PrP alleles (Table 2). The sheep were obtained from 26 flocks and ranged in age from 2 to 10 (median = 3) years at the time of diagnosis. All 30 samples were homozygous for methionine at codon 112, alanine at codon 136, arginine at codon 154 and glutamine at codon 171 (AA-136, QQ-171). These findings are consistent with those reported by Westaway et al. (1994) and extend the sample size of U.S. Suffolk sheep tested to 61 scrapie affected animals, all of which were homozygous for glutamine at codon 171.
We then determined the allelic frequency of the AA-136, QQ-171 genotype in a sample of clinically normal Suffolk sheep. Codon 136 alleles were determined by PCR-RFLP analysis of DNA from 22 rams and 14 ewes, representing foundation or breeding stock from 8 of the 12 flocks. Additionally, all sheep in flocks 1 and 2 were sampled. Alleles encoding valine at position 136 were found in 9 of 22 offspring of a single ram in flock 1 and in an unrelated ewe in a second flock. V-136 has been reported only rarely in Suffolk sheep in the U.S. (Westaway, 1994), Japan (Ikeda, 1995) and Britain (Hunter, 1994). The occurrence of this allele in 2 of the 8 flocks examined in this study suggests that the allelic frequency of V-136 may be higher than originally reported, although restricted to particular blood lines. A larger study of codon 136 polymorphisms in Suffolk sheep in the U.S. is in progress.
All flock samples suitable for PCR amplification were analyzed using probes specific for the Q- and R-encoding alleles. During the course of this study, a third allele at codon 171 (H) was found in an independent sample of U.S. Suffolk and Cotswold sheep (Mickelson, unpublished data) and has recently been reported in Texel sheep (Belt, 1995) and Japanese Suffolk sheep (Ikeda, 1995). The Q and R allele-specific probes do not detect the H-encoding allele; thus, heterozygotes that are in fact QH-171 and RH-171 were initially determined to be QQ-171 and RR-171 respectively. Following development of the H-171 probe, 329 sheep initially typed as QQ or RR from flocks 5 through 11 were re-analyzed for the H allele.
Numbers of sheep within each observed genotype are given in Table 2. The frequency of the Q, R, and H alleles was 0.76, 0.23, and 0.01. The H allele was analyzed in flocks 5 through 11 only. Eleven heterozygous sheep (7 QH and 4 RH) were found; no sheep homozygous for 171-H were identified. Ten of the 11 sheep carrying the H allele were sired or grandsired by a ram that has been widely used in artificial insemination programs. The eleventh animal did not share this sire. The true incidence of H-171 in the U.S. may be higher than shown in this study, but may be restricted to particular bloodlines.
Analysis of genotypes and allelic frequencies in this population using the Hardy-Weinberg formula demonstrated that the alleles are in genetic equilibrium and that there has been neither selection for heterozygotes nor against homozygotes. Genetic equilibrium among PrP genotypes was also observed in smaller studies of Suffolk sheep in the U. S. (Westaway, 1994) and Japan (Ikeda, 1995).
This study demonstrated that all 30 scrapie affected sheep examined were homozygous for AA-136, QQ-171, thus providing experimental support for efforts to reduce the incidence of scrapie through selective breeding based on PrP genotypes. However, the results of this study must be interpreted with caution by producers using the QR-171 or RR-171 genotype as a sole selection criterion for reduced susceptibility to ovine scrapie. V-136, which is associated with high susceptibility to strain A scrapie (Ikeda, 1995), was found in 2 unrelated Suffolk lines in this study. Although strain A scrapie has yet to be reported in U.S. Suffolks, producers cannot rule out the presence of this strain at low incidence or the introduction of this strain from other countries. Further, natural and experimental scrapie in a small number of Suffolk sheep with the AA-136, RR-171 or AA-136, QR-171 genotype has been reported in Japan (Ikeda, 1995). Scrapie strain differences, dose and route of exposure, or additional genetic loci may yet be demonstrated to influence the development of scrapie in Suffolk sheep.
We thank the owners of 12 flocks for providing us with registration records and allowing us to obtain blood and tissue samples. Drs. A. Jenny, W. Taylor, A. Davis, L. Detwiler, R. Hand, D. Herriott, M. Knowles, G. Weybright, L. Carpenter, R. Westly, G. Brickler, and D. Harpster of APHIS provided tissue samples, referrals, and invaluable discussion. We thank Dr. Donald Knowles for review of the manuscript.
| Flock | Size | Q, R, H | Q, R only |
|---|---|---|---|
| 1 | 47 | 0 | 23 |
| 2 | 20 | 0 | 20 |
| 3 | 12 | 0 | 12 |
| 4 | 73 | 0 | 69 |
| 5 | 50 | 46 | 0 |
| 6 | 76 | 36 | 22 |
| 7 | 17 | 16 | 1 |
| 8 | 79 | 66 | 4 |
| 9 | 11 | 2 | 7 |
| 10 | 152 | 101 | 9 |
| 11 | 112 | 86 | 6 |
| 12 | 22 | 0 | 19 |
| total | 671 | 353 | 192 |
| Scrapie - affected: | 30 | 0 | |
| Flock | QR | RR | QHa | RHa | ||||||
|---|---|---|---|---|---|---|---|---|---|---|
| - | n | % | n | % | n | % | n | % | n | % |
| 1 | 12 | 56.0 | 9 | 36.0 | 2 | 8.0 | ||||
| 2 | 18 | 90 | 2 | 10 | 0 | |||||
| 3 | 5 | 41.7 | 5 | 41.7 | 2 | 16.7 | ||||
| 4 | 34 | 49.3 | 32 | 46.4 | 3 | 4.4 | ||||
| 5 | 24 | 52.2 | 19 | 41.3 | 3 | 6.5 | 0 | 0 | ||
| 6 | 49 | 84.5 | 9 | 15.5 | 0 | 0 | 0 | |||
| 7 | 3 | 17.7 | 6 | 35.0 | 1 | 5.9 | 4 | 23.5 | 3 | 17.7 |
| 8 | 46 | 65.7 | 20 | 28.6 | 1 | 1.4 | 3 | 4.3 | 0 | |
| 9 | 7 | 77.8 | 1 | 11.1 | 0 | 0 | 1 | 11.1 | ||
| 10 | 41 | 37.2 | 59 | 53.6 | 10 | 9.1 | 0 | 0 | ||
| 11 | 58 | 62.3 | 33 | 35.5 | 1 | 1.1 | 0 | 0 | ||
| 12 | 11 | 57.9 | 8 | 42.1 | 0 | |||||
| TOTALS | 308 | 56.5 | 203 | 37.2 | 23 | 4.2 | 7 | 1.3 | 4 | 0.7 |
| Scrapie: | 30 | 100 | 0 | 0 | 0 | 0 | ||||
No sheep homozygous for HH were observed in this study, either by allele-specific hybridization (flocks 5-12) or by DNA sequence analysis (scrapie-affected sheep).
Belt, P.B.G.M., I.H. Muileman, B.E.C. Schreuder, J.B. Ruijter, A.L.J. Gielkens, M.A. Smits. 1995. Identification of five allelic variants of the sheep PrP gene and their association with natural scrapie. J Gen Virol 76:509-517. Bessen, R.A., R. F. Marsh. 1994. Distinct PrP properties suggest the molecular basis of strain variation in transmissible mink encephalopathy. J Virol 68:7859-7868. Bolton, D.C., M.P. McKinley, S.B. Prusiner. 1982. Identification of a protein that purifies with the scrapie prion. Science 218:1309-1311. Carlson, G.A., C. Ebeling, S.-L. Yang, G. Telling, M. Torchia, D. Groth, D. Westaway, S.B. Prusiner. 1994. Prion isolate specified allotypic interactions between the cellular and scrapie prion proteins in congenic and transgenic mice. Proc Natl Acad Sci 91:5690-5694. Come, J.H., P.E. Fraser, P.T. Lansbury. 1993. A kinetic model for amyloid formation in the prion diseases: importance of seeding. Proc Natl Acad Sci 90:5959-5963. Dickinson A.G. 1976. Scrapie in sheep and goats. IN: Kimberlin, R. H. (Ed), Slow Virus Diseases of Animals and Man. pp. 209-241. North-Holland, Amsterdam. Gajdusek, D.C. 1993. Genetic control of nucleation and polymerization of host precursors to infectious amyloids in the transmissible amyloidoses of brain. Br Med Bull 49:913-931. Goldmann, W., N. Hunter, J.D. Foster, J.M. Salbaum, K. Beyreuther, J. Hope. 1990. Two alleles of a neural protein gene linked to scrapie in sheep. Proc Natl Acad Sci 87:2476-2480. Goldmann, W., N. Hunter, G. Smith, J. Foster, J. Hope. 1994a. PrP genotypes and the Sip gene in Cheviot sheep form the basis for scrapie strain typing in sheep. Ann NY Acad Sci 724:296-299. Goldmann, W., N. Hunter, g. Smith, J. Foster, J. Hope. 1994b. PrP genotype and agent effects in scrapie; change in allelic interaction with different isolates of the agent in sheep, a natural host of scrapie. J Gen Virol 75:989-995. Horiuchi, M., N. Yamazaki, T. Ikeda, N. Ishiguro, M. Shinagawa. 1995. A cellular form of the prion protein (PrPC) exists in many non-neuronal tissues of sheep. J Gen Virol 76:2583-2587. Hunter, N., J.D. Foster, G. Benson, J. Hope. 1991. Restriction fragment length polymorphisms of the scrapie-associated fibril protein (PrP) gene and their association with susceptibility to natural scrapie in British sheep. J Gen Virol 72:1287-1292. Hunter, N., W. Goldmann, G. Benson, J.D. Foster, J. Hope. 1993. Swaledale sheep affected by natural scrapie differ significantly in PrP genotype frequencies from healthy sheep and those selected for reduced incidence of scrapie. J Gen Virol 74:1025-1031. Hunter, N., W. Goldmann, G. Smith, J. Hope. 1994. The association of a codon 136 PrP gene variant with the occurrence of natural scrapie. Arch Virol 137:171-177. Ikeda, T., M. Horiuchi, N. Ishiguro, Y. Muramatsu, G.D. Kai-Uwe, M. Shinagawa. 1995. Amino acid polymorphisms of PrP with reference to onset of scrapie in Suffolk and Corriedale sheep in Japan. J Gen Virol 76:2577-2581. Ikegami, Y., M. Ito, H. Isomura, E. Momotani, K. Sasaki, Y. Muramatsu, N. Ishiguro, M. Shinagawa. 1991. Pre-clinical and clinical diagnosis of scrapie by detection of PrP protein in tissues of sheep. Vet Rec 128:271-275. Maciulus, A., N. Hunter, S. Wang, W. Goldmann, J. Hope, W.C. Foote. 1992. Polymorphisms of a scrapie-associated fibril protein (PrP) gene and their association with susceptibility to experimentally induced scrapie in Cheviot sheep in the United States. Am J Vet Res 53:1957-1960. Merz, P.A., R.G. Rohwer, R.J. Kascsak, H.M. Wisniewski, R.A. Somerville, C.J. Gibbs, D.C. Gajdusek. 1984. Infection specific particle from the unconventional slow virus diseases. Science 224:437-440. Miller, J.M., A.L. Jenny, W.D. Taylor, R.F. Marsh, R. Rubenstein, R.E. Race. 1993. Immunohistochemical detection of prion protein in sheep with scrapie. J Vet Diagn Invest 5:309-316. Priola, S.A., B. Caughey, R.E. Race, B. Chesebro. 1994. Heterologous PrP molecules interfere with accumulation of protease-resistant PrP in scrapie-infected murine neuroblastoma cells. J Virol 68:4873-4878. Priola, S.A., B. Chesebro. 1995. A single hamster PrP amino acid blocks conversion to protease-resistant PrP in scrapie-infected mouse neuroblastoma cells. J Virol 69:7754-7758. Prusiner, S.B. 1991. Molecular biology of prion diseases. Science 252:1515-1522. Westaway, D., P.A. Goodman, C.A. Mirenda, M.P. McKinley, G.A. Carlson, S.B. Prusiner. 1987. Distinct prion proteins in short and long scrapie incubation period mice. Cell 51:651-662. Westaway, D., V. Zuliani, C.M. Cooper, M. Da Costa, S. Neuman, A.L. Jenny, L. Detwiler, S.B. Prusiner. 1994. Homozygosity for prion protein alleles encoding glutamine-171 renders sheep susceptible to natural scrapie. Genes Devel 8:959-969.
Research Microbiologist USDA, ARS, ADRU 337 Bustad, WSU Pullman, WA 99165 TEL509-335-6020 FAX 509-335-8328Question 1. Weaned lambs were inoculated orally with 3 gm of pooled brain/spleen suspension [50/50?] in 1980. Some were observed for 9 years or so, say to 1990. The paper was received in Sept. 1996. When was the histology done, was this frozen specimens, was immuno-staining done on non-succumbing sheep, was Janice Miller at Ames the histologist, and what connection did the experiment have with the cited embryo transfer of Foote et al 1993 [same animals]? Has any of the original inoculum been frozen and stored to this day?
Answer (1) The sheep described in this paper are the animals from Table 3 of Dr. Foote's 1993 paper. When I was recruited to work on the scrapie project in the early 1990's, I selected genetics as a major focus because of the strength of Dr. Hunter's work and because control by ram selection is such a practical approach, even if not 100% effective.
Dr. Hadlow encouraged me to use goats as "you need to inoculate twice as many Suffolk sheep because only half will develop clinical disease." When I read Dr. Foote's paper and saw that this applied to his study population, I asked his successor, Dr. Holyoak, whether we might not do a "quick" retrospective on this animals. Dr. Holyoak provided me with DNA prepared earlier by Dr. Wang and Alma Maciulus when Alma was working up the Cheviots from those studies. Alma had since left the group when Dr. Holyoak elected to concentrate on embryo transfers rather than extended genetic studies.
Alma Maciulusto, who initiated this work, and Dr.Foote have retired, and Dr. Clarke was in Montana, so the study was far from "quick". However, the work eventually was done. The original histology for the 1993 Foote paper was done at Ames at National Veterinary Services Labs. I had some of the 171QR slides recut and read by Dr. Bill Taylor.
Immunohistochemistry was done on some, but not all, because we had no information about the length of time the tissues were held in formalin before being set up in blocks. The long formalin fixation reduces the likelihood of seeing PrP-Sc staining and I didn't want to represent these tissues as PrP-Sc negative under these conditions. Dr. Holyoak reports that none of the original inoculum exists anywhere, although I also was very interested in genotyping it.
Question 2. I thought the paper concluded with a nice discussion of the 'carrier' animal issue. Do you have transmission experiments underway from non-succumbing sheep to, say, high-risk genotype animals? I am thinking of the Lazmesas mice here.
The reason I ask is that with 5 dimorphisms, there would be, iln theory, 32 haplotypes and 1024 genotypes. After 3-4 passages, the scrapie isoform form would have a covalent protein structure reflecting the host's genome. It would seem that the inoculum could have been a mix of species of prion amino acid sequences. In the worst case scenario, sheep-sheep could have a much greater 'species barrier' than say great ape to human, in terms of the number of amino acid differences. Answer (2) Yes, that experiment is in progress. However, we are repeating the initial inoculations, in part because of the issues you raised in question 3.
Question 3. I wasn't clear on the genotype of the sheep providing the [CH1641?] scrapie inoculum. Was the material pooled from a number of animals from a number of flocks representing typical US Suffolk prion genotype frequencies or just from a small number of animals? It seems for 141 animals and 1.5 gms brain/animal that just one animal might have provided enough material.
Answer (3) I don't have further information on Dr. Foote's inoculum pool. For the experiment in progress, we are using a single brain from one sheep for which we determined the sequence of the entire open reading frame. Half the brain was formalin fixed and showed classic histologic lesions and good PrP-Sc staining. The recipients have all be sequenced and brain and lymphoid tissues from survivors will be subinoculated to susceptible sheep.
Thanks for spending so much time and expertise for maintaining a Web site. I used your site last month to download the Inveresk gelatin study prior to the FDA meeting. I was provided with short list of the omissions or typos but on the whole it was a fast, efficient way to get information, even if it probably was not intended for publication on the internet.
More Answers: (Dr. Nora Hunter) 13 May 97
Re: the inoculum used by Dr Foote.
This was not CH1641 which is one of ours. It originated as natural scrapie in a Cheviot sheep (V136) with eartag number 16X41. It was subsequently passaged into ARQ/ARQ Cheviot sheep. The inoculum is pooled from a number of brains and contains all the possible AA136 genotypes, found by PCR. Make of that what you will! It affects the same genotype in Cheviots as that which is most susceptible to scrapie in Suffolks but is not a Suffolk scrapie source.
Pools of animal brain were used in the "old days" because, I think, genotypes in terms of the Sip gene were thought to be simple - only three genotypes. We have only realised the error of this recently. Archival analysis