Prion disease
Mad Cow Home ... Best Links ... Search this site

CJD Surveillance Unit annual report
Repeated surgery -- enhanced risk for sporadic CJD?
Cow prion with 7 repeats
Role for B cells in neuroinvasive scrapie
Mini-prion up and running
PNAS okays web preprints
Ancestral origin of E200K: 6 founding mutations in 62 families
Heparan sulfate-binding site on Apo-serum amyloid A and therapeutic intervention
Increase of neuron-specific enolase in patients with CJD
Limited detection of sternal bone marrow infectivity
A systematic search for repeat conformational disorders
Mouse prion glycans determined
Real biological role for yeast prions?
Refinement of hamster nmr
UK research projects in TSEs

CJDSU 7th Annual report (for 1998)

Sat, 10 Apr 1999  CJDSU Web site
12 Apr 99 release of further nvCJD statistics expected

Comment (webmaster): This is an excellent document, much more detailed than what is offered at DoH. Oddly is no plot of the ages at onset, though this is given for age at death for sporadic CJD in Fig 2; under-30 data cannot be read here but is presented in table 2: since 1970, 2 sporadic CJD cases out of 758 were under 30 years of age. It would be good to display the overlap of nv and sporadic age distributions. There is no information on whether the age distribution of nvCJD is widening over time -- the oldest age of onset is now 52 years. The long-requested collaborative brain/tissue bank is up and running as well. Table 18 even lists names of scientists receiving samples.

Figure 5 [below] is what we have been asking for. It provides patient identification numbers, date of onset, notification [referral to Unit], date of death, and date of confirmation. It thus continues a graph in an earlier Lancet article. The unofficial average lag (months between onset of nvCJD and DoH reporting = onset to confirmation/death + 2 months) can be read off accurately from the graph using pixel counting as 17.7+2 = 19.7 months (7.3 std dev). Thus in January, 2002 we will be getting data for the onsets of nvCJD in May 1999. There is an apparent trend to lag reduction to about 13.5 +2 months in the last year.

The raw lags ordered by date of onset are 30.0, 23.5, 38.1, 15.3, 18.7, 18.3, 31.3, 12.5, 17.1, 14.5, 12.0, 12.7, 14.3, 9.4, 32.0, 17.8, 10.9, 23.7, 17.4, 16.2, 12.3, 15.3, 26.8, 29.9, 13.6, 11.4, 18.5, 12.8, 14.6, 15.9, 14.7, 14.2, 12.2, 11.4, 8.4 months + 2 for DoH

The raw lags ordered by increasing number of months are 8.4, 9.4, 10.9, 11.4, 11.4, 12.0, 12.2, 12.3, 12.5, 12.7, 12.8, 13.6, 14.2, 14.3, 14.5, 14.6, 14.7, 15.3, 15.3, 15.9, 16.2, 17.1, 17.4, 17.8, 18.3, 18.5, 18.7, 23.5, 23.7, 26.8, 29.9, 30.0, 31.3, 32.0, 38.1 months + 2 for DoH.

Highlights of the report:

"Up to 31st December 1998, 35 cases of nvCJD had been identified in the UK (33 definite, 2 probable), all of whom had died. Twenty of the 35 cases were women. The median age at onset of disease was 28 years and the median age at death 29 years (compared with 65 years for the median age at death for sporadic CJD). The youngest case was aged 16 years at onset while the oldest case was aged 52 years. The median duration of illness was 14 months (range 8-38). The median delay between onset of disease and confirmation of the diagnosis of nvCJD was 15 months (with a range 7.2 - 32.0 months). This has not decreased over time. Since the first case of nvCJD, with onset in early 1994, there has been no evidence that the rate of occurrence of new cases has increased over time (Figure 5). Analyses which adjust for delays in reporting and confirmation have found no evidence that the incidence rate of nvCJD has increased during the period 1994-1997 (P.Farringdon, personal communication)."

There is a good section later on lack of medical history risk for the nvCJD caseload. Note also their caseload [2,712 paraffin blocks, 15,581 slides] includes 17 suspected nvCJD cases from Europe and 22 from elsewhere, as well as 14 cases of kuru, plus samples from various studies:

--Study of PrPC expression in human brain - Dr Jeanne E Bell
--Haemophilia - Dr Nigel Cairns, Dr J McLaughlin, Professor M Esiri
--Kuru - Dr Catriona McLean, Professor CL Masters
--CJD mouse transmission studies - Dr J W Ironside, Dr Moira Bruce, Professor J Collinge
--Feline studies - Dr Alun Williams 
--Marmoset studies - Dr R Ridley and Dr R Baker
"In 1998, Dr Mark Head joined the CJD Surveillance Unit from a post in New York [Columbia: see Cell Biochem 1998 Dec 15;71(4):577-83 etc.] to establish a laboratory which is dedicated for the study of prion protein by Western blotting and related biochemical techniques. This methodology enhances the diagnostic technology available within the Unit, and will also facilitate identification and sub-classification of CJD cases."

Iatrogenic CJD:

"Since 1970, up to 31st December 1998, 33 cases of CJD attributable to iatrogenic exposure have been identified, 6 in individuals receiving dura mater implants and 27 in individuals who had received human-derived growth hormone (hGH) or gonadotrophin. The mean age at death of the latter group is 28.7 years (with a range of 20-45 years) and for the dura mater cases is 43.3 years (range 27-59 years).

The first identified iatrogenic case was a dura mater recipient who died in 1979. The first hGH-related death occurred in 1985. Between 1st May 1990 and 31st December 1998 there were 24 CJD deaths in hGH recipients, an average of nearly 3 deaths per year."

Unlike the recent and thorough Australian Lancet study, there was no evidence that having undergone an operation was associated with increased risk of sporadic CJD. But as both studies point out, it is ill-advised to use hospital controls if these themselves are at increased risk of CJD from surgery.

Familial CJD:

"Thirty-four cases of familial CJD have been identified since 1970, excluding cases of GSS. Of these, 32 were resident in England and and 2 were resident in Wales. Thirteen of the cases had insertions in the coding region of the PrP gene, 8 carried the mutation at codon 200 (Glu-Lys), 2 at codon 178 (Asp-Asn, both with methionine at codon 129), 1 at codon 117 (Ala-Val) and 1 at codon 210 (Val-Ile). Nine were identified as familial on the basis of relatives known to have had CJD (one with a relative known to have an insertion, one with a relative known to have the codon 200 mutation). The mean age at death was 55.8 years (with a range 38 - 68 years)."

Comment (webmaster): This says that a lot of familial CJD is missed if only a questionaire is used, ie 9/34 is only 26%. While the report is unclear, it seems that 25/34 represent new kindreds. They do not give any data on how many cases had a family history of dementia or 'Alzheimer' not diagnosed as CJD. The percentage of familial is 34/(758+34)= 4.3%. Aggravatingly, they do not provide good numbers for GSS; 3 cases in 32 months would roughly double the percentage of familial CJD

Surgical treatment and risk of sporadic Creutzfeldt-Jakob disease: a case-control study.

Lancet 1999 Feb 27;353(9154):693-7
Collins S, Law MG, Fletcher A, Boyd A, Kaldor J, Masters CL
Apart from the small number of iatrogenic and familial cases, the cause of most cases of Creutzfeldt-Jakob disease (CJD) is not known. We aimed to identify risk factors for sporadic CJD. In a case-control study, we compared the medical history and selected demographic characteristics of 241 definite (neuropathologically confirmed) and probable (clinically likely) patients with CJD, ascertained from the Australian National Creutzfeldt-Jakob Disease Registry between Jan 1, 1970, and October 31, 1997, and of 784 controls, recruited from the community by random telephone interview in August, 1997. Standard logistic regression was used for the comparisons.

Surgical procedures were significantly associated with the development of sporadic CJD. This risk progressively increased with the number of surgical treatments to a maximum for three procedures (odds ratio 2.13 [95% Cl 1.34-3.41], p=0.002). There was also a significant association between risk of CJD and residence or employment on a farm (p<0.001) or market garden (p=0.002) for longer than 10 years. We found no significant risk associated with a history of blood transfusion, organ transplantation, major dental work, or occupation.

Our findings accord with the hypothesis that a range of surgical treatments may serve as unrecognised contamination events and account for a proportion of cases of sporadic CJD. Possible biases in different methods and times for the acquisition of data on cases and controls suggest our findings need to be replicated in independent studies with community controls.

Comment (webmaster): This is an excellent study. Its key point is in not to use other hospital patients as controls because these unsurprisingly also have more surgeries than the general population and hence are unsuitable for controlling for sporadic CJD from contaminated surgical instruments because they too would have a higher level. What is shocking here is that many previous studies had all used these hospital controls and apparently missed a striking effect. While further work is needed, it appears that quite a bit of sporadic CJD could have a simple explanation after all.

Cow prion with 7 repeats

GenBank posting of 23 Mar 99 AJ132392
This new cow allele showed up recently though no article has appeared yet. Cows (and other bovidae) normally have 5 or 6 repeats. The sequence here has 7, which is getting closer to lengths clearly causative for familial CJD in humans. The allele is most easily explained by replication slippage of repeat 5 (a 35 bp ambiguity zone begins after its first codon) from a 6-repeat cow. A second silent allelic variation occurs at the end of the third repeat (A instead of normal G), position 143 in their fragment. The GenBank entry is marred by a terminal PCR frameshift error. ggt-gtaccc instead of ggtggtaccc. Familial BSE remains a strong candidate for the originally amplified founder case of the BSE epidemic, as well as for susceptibility alleles.

Joerg Schlaepfer, a postdoc with G. Dolf, has worked previously on canine and bovine chromosomal maps, establishing the order as centromere-PRNP-(SOD1L/AVP/OXT)-(BL42/GNAS1) on bovine chromosome 13. Current investigations in context with BSE:

"The bovine spongiform encephalopathy (BSE) outbreak in Great Britain and other countries such as Switzerland has developed into an economic disaster as well as a threat to public health. The very low within-herd incidence of the clinical manifestation of BSE, despite widespread exposure, strongly suggests that the disease expression is under genetic control. In species other than cattle the expression of BSE clearly is associated with polymorphisms within the prion protein gene (PRNP). In this study we are looking for possible associations between BSE and the regions of the PRNP on bovine chromosome 13 and the BOLA cluster on bovine chromsome 23."

This comment is somewhat mysterious. Bovine chr 23 corresponds to human chr 6. Serological and biochemical analysis of lymphocyte cell surface antigens provided the first evidence for highly polymorphic MHC genes in cattle and other ruminant species. The major histocompatibility complex (MHC) of cattle was thus named the bovine leucocyte antigen (BoLA) system. But the only thing that looks promising here are homologous genes for the chaperone Hsp 70:

human BF
human BTN
human C4A
human CYP21
human GLO1
human HLA-DOB (cattle BOLA-DIB)
human HSPA1A (cattle HSP70-1)
human PSMB9 
human TCP1

Reported fragment of 7 repeat cow:
gaggaggatggaacactggggggagccgatacccaggacagggcagtcctggaggcaaccgt
   G  G  W  N  T  G  G  S  R  Y  P  G  Q  G  S  P  G  G  N  R 
tatccacctcagggagggggtggctggggtcagccccatggaggtggctggggccagcct
 Y  P  P  Q  G  G  G  G  W  G  Q  P  H  G  G  G  W  G  Q  P 
catggaggtggctggggccaacctcatggaggtggctggggtcagccccatggtggtggc
 H  G  G  G  W  G  Q  P  H  G  G  G  W  G  Q  P  H  G  G  G 
tggggacagccacatggtggtggctggggacagccacatggtggtggaggctggggtcaa
 W  G  Q  P  H  G  G  G  W  G  Q  P  H  G  G  G  G  W  G  Q 
ggt-gtaccc  [PCR error, should be ggt accc]
 G  V  P  

G  G  W  N  T  G  G  S  R  Y  P  G  Q  G  S  P  G  G  N  R Y  P  
P  Q  G  G  G  G  W  G  Q  
P  H  G  G  G     W  G  Q  
P  H  G  G  G     W  G  Q  
P  H  G  G  G     W  G  Q  
P  H  G  G  G     W  G  Q  
P  H  G  G  G     W  G  Q  
P  H  G  G  G  G  W  G  Q  
G  V  P  

Mouse prion glycans determined


 Comment (webmaster): Determining the covalent structure of the prion protein has proven enormously difficult.   This paper represents a very signficant step forward on the attached carbohydrates; the modified arginines and the copper remain undetermined.     

Notice the immense ramifications of this for strain types: the fibrils are polymerizing out of a soup of 60 x 60 = 3600 glycan variants before even getting to ragged N and C termini. And of course, other animal species, other cell types, with and without various transmissions, and the human strain types 1-4 remain to be studied.

Prions are a very unfavorable experimental model system for amyloid diseases, yet the work must go on.

Site-Specific Characterization of the N-Linked Glycans of Murine Prion Protein by High-Performance Liquid Chromatography/Electrospray Mass Spectrometry and Exoglycosidase Digestions.

Stimson E, Hope J, Chong A, Burlingame AL
Biochemistry 1999 Apr 13;38(15):4885-4895
$25 for immediate access 
"The murine prion protein PrP gene encodes a protein of 254 amino acids with two consensus sites for Asn-linked glycosylation at codons 180 and 196. A partial site-specific study of the N-linked glycans from hamster PrP has previously been carried out by mass spectrometry [good effort in Biochemistry 32, 1991-2002 1993] and revealed that the glycosylation at Asn-181 (equivalent to mouse 180) is heterogeneous, comprising over 30 glycoforms. The identification of the glycosylated peptide spanning Asn-197 was not reported. Recent technical advances in electrospray mass spectrometry now provide the sensitivity to detect low femtomole quantities of glycopeptides with over 5000 mass resolution and 30 ppm mass measurement.

This performance coupled with stepwise exoglycosidase digestion has been employed to establish the differential nature of the structural complexity (glycoforms) of the glycans at Asn-180 and Asn-196 from a single strain infected with the ME7 strain.

Some sixty structures have been found characterized by neutral and sialylated bi-, tri-, and tetraantennary complex-type bearing outer-arm alpha(1-3)-fucosylation (the Lewisx and sialyl-Lewisx epitopes), core alpha(1,6) fucosylation, and the presence of terminal HexNAc residues. The Lewisx trisaccharide is the major nonreducing structure at Asn-180, and significant amounts of both Lewisx and sialyl Lewisx epitopes are observed at Asn-196. The abundance of the Lewisx and sialyl Lewisx epitopes on murine PrPSc may indicate a role for these structures in the normal function of PrPC or the pathophysiology of PrPSc."

PNAS okays web preprints

The Editorial Board, PNAS 13 Apr 98
"Because the mission of PNAS is to publish the results of important original research, we do not accept papers describing work that has been published before. This prohibition against double publishing is the policy of virtually all primary literature journals and hardly seems controversial. Yet, when applied too fastidiously, it constricts the free exchange of science. Authors may fear distributing preprints to review writers and commentators or putting preprints up on the web so as not to jeopardize subsequent publication. Journal policies on what constitutes prior publication vary so widely or are so vaguely stated that many authors conclude that the safe course is to restrict dissemination before publication. The aim of this editorial is to set out clearly the PNAS policy on what constitutes prior publication. Our overall philosophy is to adopt a liberal prior publication policy in which the paramount goal is free scientific exchange. We set out below specific examples of permitted and proscribed prior publication. We invite your comments.

PNAS considers results to have already been published if they have appeared in sufficient detail to allow replication, are publicly accessible with a fixed content, and have been validated by review. A paper has surely been published if it has appeared in a journal cited by any widely used abstracting service, whether in print or online, in English or in any other language. Gray areas result when two of the three criteria (replicability, public accessibility, and review) are met or only a portion of an article has appeared before. What if only one figure has been published previously? That need not doom subsequent publication in PNAS, but the authors must convince us at the time of submission that the figure is essential for the submitted paper yet not the major contribution.

Preprints have a long and notable history in science, and it has been PNAS policy that they do not constitute prior publication. This is true whether an author hands copies of a manuscript to a few trusted colleagues or puts it on a publicly accessible web site for everyone to read, as is common now in parts of the physics community. The medium of distribution is not germane. A preprint is not considered a publication because it has not yet been formally reviewed and it is often not the final form of the paper. Indeed, a benefit of preprints is that feedback usually leads to an improved published paper or to no publication because of a revealed flaw. Analogous to a preprint is the often detailed oral presentation of work at a conference. Once again we do not view this as prior publication but as a salutary step toward publication.

With the rapid expansion of the scientific literature, summaries of work in reviews, commentaries, and perspectives have become increasingly important. Also, only a few scientists are privileged to attend small elite meetings, and publication of a meeting summary allows the whole scientific community to share in some of the benefits. Unfortunately, scientists are often reluctant to provide the needed preprints or even clear descriptions of unpublished results to the summarizers because they fear it will compromise subsequent publication. The synthesizers often feel obliged to do a verbal dance of forward and backward steps to say enough to make the results clear, but not enough to prejudice later publication. PNAS policy is that a summary of work in a review, a perspective, a commentary, a newspaper or magazine article, or wherever does not constitute prior publication. Our guiding principle is that journals should interfere minimally in such exchanges; authors themselves should dictate the dissemination of their own work.

All investigators should strive to inform the public about the accomplishments, methods, and motivations of science. This is best done in the popular press. The public has a right to know what we do and why we do it. We do ask that once a paper is accepted you coordinate your discussions with reporters with the National Academy of Sciences press office so that the current procedures, which allow a wide range of journalists to gain information in an equitable fashion, are honored...

Real biological role for yeast prions?

EMBO Journal Vol. 18,pp. 1974-1981, 1999,
Simon S. Eaglestone, Brian S. Cox and Mick F. Tuite
Comment (webmaster): , are yeast prions esoteric artefactual mutations or are they used in nature as a regulatory mechanism (sequestration in fibrils to reversibly inactivate)? Here they show an effect -- too bad wild type yeast didn't elect to use it.

Translation termination efficiency can be regulated in Saccharomyces cerevisiae by environmental stress through a prion-mediated mechanism

[PSI+] is a protein-based heritable phenotype of the yeast Saccharomyces cerevisiae which reflects the prion-like behaviour of the endogenous Sup35p protein release factor. [PSI+] strains exhibit a marked decrease in translation termination efficiency, which permits decoding of translation termination signals and, presumably, the production of abnormally extended polypeptides. We have examined whether the [PSI+]-induced expression of such an altered proteome might confer some selective growth advantage over [psi-] strains.

Although otherwise isogenic [PSI+] and [psi-] strains show no difference in growth rates under normal laboratory conditions, we demonstrate that [PSI+] strains do exhibit enhanced tolerance to heat and chemical stress, compared with [psi-] strains. Moreover, we also show that the prion-like determinant [PSI+] is able to regulate translation termination efficiency in response to environmental stress, since growth in the presence of ethanol results in a transient increase in the efficiency of translation termination and a loss of the [PSI+] phenotype. We present a model to describe the prion-mediated regulation of translation termination efficiency and discuss its implications in relation to the potential physiological role of prions in S.cerevisiae and other fungi.

Hamster nmr refinement

27 Apr 99 Biochemistry free full text
Comment (webmaster): This is a very thorough and instructive article but the subject of a crazy press release. The refined structure was posted some time back at Brookhaven and commented on earlier. This means that now mouse and hamster have refined solution nmr structures( see Figure 13) The figures in this paper are excellent : the hydrogen-deuterium exchange graphic is very helpful.

The repeat region, the modified arginines, the glycans, the copper and so on may have a very significant impact on the transition region discussed here, which is the most evolutionary stable part of the molecule. A structure based on xray was proposed earlier by Inouye et al. This paper agrees that there is some structure here. A superposition results in two arrangements (Figure 9.) that seems similar to the Inouye structure. The region could be far less mobile if the adjacent repeat region and its copper were present. If this region is a molecular switch -- and this has not been proven -- its normal function remains as obscure as ever.

NMR has been used to refine the structure of Syrian hamster (SHa) prion protein rPrP(90-231), which is commensurate with the infectious protease-resistant core of the scrapie prion protein PrPSc. The structure of rPrP(90-231), refolded to resemble the normal cellular isoform PrPC spectroscopically and immunologically, has been studied using multidimensional NMR; initial results were published [James et al. (1997) Proc. Natl. Acad. Sci. U.S.A. 94, 10086-10091]. We now report refinement with better definition revealing important structural and dynamic features which can be related to biological observations pertinent to prion diseases. Structure refinement was based on 2778 unambiguously assigned nuclear Overhauser effect (NOE) connectivities, 297 ambiguous NOE restraints, and 63 scalar coupling constants (3JHNHa).

The structure is represented by an ensemble of 25 best-scoring structures from 100 structures calculated using ARIA/X-PLOR and further refined with restrained molecular dynamics using the AMBER 4.1 force field with an explicit shell of water molecules. The rPrP(90-231) structure features a core domain (residues 125-228), with a backbone atomic root-mean-square deviation (RMSD) of 0.67 ‰, consisting of three -helices (residues 144-154, 172-193, and 200-227) and two short antiparallel -strands (residues 129-131 and 161-163).

The N-terminus (residues 90-119) is largely unstructured despite some sparse and weak medium-range NOEs implying the existence of bends or turns. The transition region between the core domain and flexible N-terminus, i.e., residues 113-128, consists of hydrophobic residues or glycines and does not adopt any regular secondary structure in aqueous solution. There are about 30 medium- and long-range NOEs within this hydrophobic cluster, so it clearly manifests structure. Multiple discrete conformations are evident, implying the possible existence of one or more metastable states, which may feature in conversion of PrPC to PrPSc. To obtain a more comprehensive picture of rPrP(90-231), dynamics have been studied using amide hydrogen-deuterium exchange and 15N NMR relaxation times (T1 and T2) and 15N{1H} NOE measurements. Comparison of the structure with previous reports suggests sequence-dependent features that may be reflected in a species barrier to prion disease transmission.

A crucial role for B cells in neuroinvasive scrapie.

Transfus Clin Biol 1999 Feb;6(1):17-23 
Brandner S, Klein MA, Aguzzi A
...Neurological disease after peripheral inoculation depends on prion expansion within cells of the lymphoreticular system. In order to identify the nature of the latter cells, we inoculated a panel of immune deficient mice with prions intraperitoneally. While defects affecting only T lymphocytes had no apparent effect, all mutations affecting differentiation and responses of B lymphocytes prevented development of clinical scrapie. Since absence of B cells and of antibodies correlates with severe defects in follicular dendritic cells (FDCs), the lack of any of these three components may prevent clinical scrapie.

Yet, mice expressing immunoglobulins exclusively of the M subclass without detectable specificity for PrPc, and mice with differentiated B cells but lacking functional FDCs, developed scrapie after peripheral inoculation: therefore, differentiated B cells appear to play a crucial role in neuroinvasion of scrapie regardless of B-cell receptor specificity.

Prion protein of 106 residues creates an artifical transmission barrier for prion replication in transgenic mice.

Cell 1999 Mar 19;96(6):869-78 
Supattapone S, Bosque P, Muramoto T, ... DeArmond SJ, Prusiner SB, Scott M
A redacted prion protein (PrP) of 106 amino acids with two large deletions was expressed in transgenic (Tg) mice deficient for wild-type (wt) PrP (Prnp0/0) and supported prion propagation. RML prions containing full-length PrP(Sc)produced disease in Tg(PrP106)Prnp0/0 mice after approximately 300 days, while transmission of RML106 prions containing PrP(Sc)106 created disease in Tg(PrP106) Prnp0/0 mice after only approximately 66 days on repeated passage.

This artificial transmission barrier for the passage of RML prions was diminished by the coexpression of wt MoPrPc in Tg(PrP106)Prnp+/0 mice that developed scrapie in approximately 165 days, suggesting that wt MoPrP acts in trans to accelerate replication of RML106 prions. Purified PrP(Sc)106 was protease resistant, formed filaments, and was insoluble in nondenaturing detergents. The unique features of RML106 prions offer insights into the mechanism of prion replication, and the small size of PrP(Sc)106 should facilitate structural analysis.

Limited detection of sternal bone marrow infectivity

Veterinary Record 1999 March 13; 144: 292-294
G.A.H. Wells, S.A.C. Hawkins, R.B. Green, Y.I. Spencer, I. Dexter, M. Dawson
A RECENTLY published report (Wells and others 1998) updated interim findings in a sequential time point study which is examining the spread of infectivity and development of pathological changes in cattle exposed orally to infection with the agent of bovine spongiform encephalopathy (BSE) (Wells and others 1994, 1996).

These previous results described the schedule of examination of cattle, killed from two to 40 months after oral exposure, and the development of clinical signs in cattle 35 to 37 months after the exposure. They also demonstrated infectivity by mouse bioassay in distal ileum (sampled from cattle six to 8 months, 38 months and 40 months after exposure); central nervous system - brain and spinal cord (sampled from cattle 32 to 40 months after exposure); and sensory ganglia - dorsal root ganglia (sampled from cattle 32 to 40 months after exposure) and trigeminal ganglion (sampled from cattle 36 months and 38 months after exposure). No infectivity had been detected in any of the 33 remaining tissues for which assays were complete at June 1997 (that is, those sampled from cattle two to 22 months after exposure).

Mouse bioassays of a large range of tissues from all sequential kill time points of the study have now been completed (at December 1998) and will be reported in full elsewhere. This short communication reports additional data on the bioassay in C57B1-J6 mice of bone marrow, completing results for this tissue from all cattle in the study (Wells and others 1998).

... Evidence of infectivity in bone marrow by morphological and IHC criteria was confined to cattle killed 38 months after exposure (Table 1). The two mice assessed as clinically affected had incubation periods of 695 days and 842 days and were confirmed positive for spongiform encephalopathy by histopathological examination. In addition to these two mice, four additional mice in the group with survival times of 653, 792, 799 and 923 days had evidence of PrP immunostaining in the brain. In all five mice considered positive by ICH, detection of prp was obtained with both antisera. Mice examined from the bioassays of the bone marrow completed from cattle killed 32, 36 and 40 months after exposure and from the clinically normal control cattle were negative clinically, histopathologically and immunohistochemically.

There have been few studies in which assays of infectivity in bone marrow of animals with natural infection with the agents of the transmissible spongiform encephalopathies have been attempted. Hadlow and others (1982) detected a very low concentration of infectivity by mouse bioassay in bone marrow of one of nine Suffolk sheep clinically affected with natural scrapie from a flock assembled of sheep from infected farm flocks. In all nine sheep infectivity was widespread and in moderate to high titre in lymphatic and nervous system tissues. Bone marrow was not among the tissues assayed (W. J. Hadlow, personal communication) from any of the 34 lambs and sheep studied for evidence of preclinical infection in this flock.

Mouse assays of infectivity in bone marrow from three adult goats with natural scrapie failed to detect the agent (Hadlow and others 1980). Examinations of bone marrow infectivity in experimentally induced TSR have been equally infrequent. In a study in mice (Eklund and others 1967) the inoculum was comprised of whole femur derived from random-bred Swiss mice infected by subcutaneous injection with the Chandler strain of mouse-adapted scrapie agent. Infectivity was detected at a low concentration from early in the clinical disease and throughout it, with increasing but variable concentrations comparable with those found in non-neural lymphoreticular tissues.

... In their study of the distribution of Scrapie agent in goats experimentally infected with the Chandler strain, Hadlow and others (1974) did not detect infectivity in bone marrow at any time through the incubation or clinical course of the disease. In all of these assays, the calculated limit of detectability of infectivity by intracerebral inoculation of mice is approximately 10^2 log10 mouse intracerebral LD50/g of tissue (Kimberlin 1994). In the single sheep in which infectivity was detected in bone marrow (Hadlow and others 1982) the titre of agent was close to this limit of detectability.

Similarly, mouse assays of infectivity of bone marrow from two naturally affected cattle with BSE have given negative results, as indeed have all assays of non-neural tissues from natural cases of the disease (Fraser and Foster 1994; H. Fraser, personal communication). These assays used a combination of intracerebral and intraperitoneal injections with a calculated limit of detectability of 10^1.4 LD50/g (Kimberlin 1996). In studies to examine the tissue distribution of infectivity in human spongiform encephalopathies by inoculation of primates (mostly squirrel monkeys) with 1 to 20 per cent tissue suspensions, no infectivity was found in the bone marrow of the only two patients (disease unspecified) from which the tissue was examined (Brown and others 1994).

The involvement of bone marrow in the course of scrapie would seem to be a phenomenon occurring rarely and then only at the end of the incubation period. In the present study also, only one of the three exposed cattle need have contributed bone marrow with detectable infectivity to the tissue pool assayed. Although this possible dilution effect would be inconsequential, the results do not allow an estimation of the concentration of infectivity in bone marrow since the C57BI-J6 mice used throughout this series of bioassays have given a wide incubation period range for any given inoculum (Wells and others 1998 and unpublished data) and a dose response curve for BSE infectivity in bone marrow has not been obtained....

It is difficult to draw conclusions on the origin of the infectivity in bone marrow in experimental BSE, but three possibilities must be considered. The first is that it is the result of the spread of infectivity from the CNS to the peripheral nervous system (PNS) in the clinical phase of disease. Studies of experimental scrapie in mice have demonstrated the spread of the infection from CNS to peripheral nerves (Kimberlin and others 1983). Since bone marrow does have an autonomic innervation, largely supplying smooth muscle of blood vessels (Wickramasinghe 1992), BSE infection could theoretically spread directly from the CNS via the PNS. While infectivity in this study has been demonstrated in dorsal root ganglia, concurrent with infectivity in the CNS, the present failure to detect evidence of infection in those autonomic ganglia or peripheral nerve trunks assayed (Wells and others 1996, 1998) may be a consequence of the concentration being below the limit of detectability.

Also, for this hypothesis to be tenable, the tissue innervated must contain cells which support the replication of the agent. While, as discussed later, this might be feasible for bone marrow, it would seem that replication within blood vessels per se might be expected to lead to a more widespread distribution of infectivity in the clinical phase. Failure to detect infectivity in bone marrow from cattle killed at 40 months after exposure might also argue against the phenomenon being related to a progression of tissue involvement by spread along peripheral nerves in the clinical phase of disease.

The second possibility is that infection reaches the bone marrow (albeit undetected) via the circulation. Haematogenous dissemination of infectivity to lymphoreticular sites is an accepted feature of pathogenesis early in the incubation period of experimental rodent scrapie, when infection has been by non-neural routes (for reviews see Kimberlin and Walker 1988, Scott 1993).

BSE infectivity may be transported to bone marrow, via blood, early in the incubation period or only at the clinical stage of disease. However, in both situations, the evidence from studies of scrapie and TME predicts that if BSE infectivity can be detected in bone marrow, it should also be detected in spleen and lymph nodes in equal, if not greater, concentrations. This is supported not only by data on infectivity at these latter sites in previously cited studies which have included assays of bone marrow (Eklund and others 1967, Hadlow and others 1974, 1980, 1982) but by the fact that bone marrow is, in common with spleen and lymph nodes, a location of the long-lived cells considered to be crucial to replication of scrapie agents (Fraser and others 1986).

However, in the present study of experimental BSE in cattle (Wells and others 1998) and in studies of confirmed field cases of BSE (Fraser and Foster 1994; H. Fraser, personal communication) infectivity has not been detected in spleen or lymph nodes. lt is also interesting that in a further study, still in progress, cattle inoculated intracerebrally as calves with pools of spleen or multiple regional lymph nodes from cattle terminally infected with BSE are all surviving (as of December 1998) at 72 months after inoculation (G. A. H. Wells, S. A. C. Hawkins, unpublished observations). This period is approximately 40 months greater than the apparent end point of an as yet incomplete titration of BSE infected brain stem by intracerebral inoculation in cattle (G. A. H. Wells, S. A. C. Hawkins, unpublished observations). This suggests that any infectivity in these lymphoreticular tissues, at least at the terminal stage of disease in natural BSE is below detectability even by within species assay.

This inconsistency raises a third possibility, namely that the detection of BSE infectivity in bone marrow taken 38 months after infection was the result of contamination of one (possibly more) of the samples used to make the pooled inoculum. Given the large number of tissues collected from each animal and the fact that sternal bone marrow was the last tissue to be taken in the sequence of harvesting tissues at necropsy, it is difficult to exclude all possibilities of contamination, even with the extreme care exercised in the present studies. The risk of BSE contamination from a small amount of, for example, CNS is greatest when animais are clinically affected. That this result is related to an episode of contamination is consistent with the absence of detectable infectivity in bone marrow samples from clinically affected cattle killed at 40 months after inoculation. Nevertheless, the result is also consistent with the limited evidence of previous studies that the occurrence of infection in bone marrow in these diseases is a rare event and probably not part of the general pathogenetic pattern.

The application of PrP detection to morphological assessment of brains of mice in qualitative mouse bioassays for TSE infectivity has considerable implication for this and future similar studies. Clear distinctions must be drawn between its application for the most sensitive available means of detection of disease in recipient mice used in a qualitative assay as here, and application to a quantitative bioassay for detection of the concentration of infectivity in a tissue. The latter changes the mathematical basis of the assay. Limited experience to date of the former application using PrP IHC indicates that it is a useful adjunct in the assay, especially to resolve results equivocal on the basis of morphological observations alone. The retrospective inclusion of this method for bioassays in this study is being considered.

Ancestral origins and worldwide distribution of the Prnp E200K mutation causing familial CJD.

Am J Hum Genet 1999 Apr;64(4):1063-1070 
Lee HS, Sambuughin N, Cervenakova L, Chapman J, Pocchiari M, Litvak S, Qi HY, Budka H, del Ser T, Furukawa H, Brown P, Gajdusek DC, Long JC, Korczyn AD, Goldfarb LG
Comment (webmaster): This looks to be a nice modern study that corrects the incidence of a type of familial CJD for distinct events. It would be interesting to put this together with the recent paper in Nature that estimated rates genomewide in humans. There are no shortage of microsatellite DNA markers known now (and the complete human genome is now due next spring) so this study is hopefully a model for the other point mutations as wel as repeat region deletions.

Of the 62 families with E200K, they find two large groups that seemingly trace back to a founding mutational event in the middle ages. It seems that the total number of founding events is 6 and the rest is due to progeny.

This shows how a deleterious mutation can drift into a fairly high frequency, along the lines of the 3,000 member Indiana kindred F198S. E200K is of course a high frequency CpG mutational site like D178N and P102L. The bottom line is that familial CJD is even rarer than previously thought (after correcting for kindreds), about one tenth the nominal rate.

Abstract: CJD belongs to a group of prion diseases that may be infectious, sporadic, or hereditary. The E200K point mutation in the PRNP gene is the most frequent cause of hereditary CJD, accounting for >70% of families with CJD worldwide. Prevalence of the 200K variant of familial CJD is especially high in Slovakia, Chile, and Italy, and among populations of Libyan and Tunisian Jews.

To study ancestral origins of the 200K mutation-associated chromosomes, we selected microsatellite markers flanking the PRNP gene on chromosome 20p12-pter and an intragenic single-nucleotide polymorphism at the PRNP codon 129. Haplotypes were constructed for 62 CJD families originating from 11 world populations. The results show that Libyan, Tunisian, Italian, Chilean, and Spanish families share a major haplotype, suggesting that the 200K mutation may have originated from a single mutational event, perhaps in Spain, and spread to all these populations with Sephardic migrants expelled from Spain in the Middle Ages.

Slovakian families and a family of Polish origin show another unique haplotype.

The haplotypes in families from Germany, Sicily, Austria, and Japan are different from the Mediterranean or eastern European haplotypes.

On the basis of this study, we conclude that founder effect and independent mutational events are responsible for the current geographic distribution of hereditary CJD associated with the 200K mutation.

Increase of neuron-specific enolase in patients with Creutzfeldt-Jakob disease.

 Neurosci Lett 1999 Feb 12;261(1-2):124-6 
Kropp S, Zerr I, Schulz-Schaeffer WJ, Riedemann C, Bodemer M, Laske C, Kretzschmar HA, Poser S
Creutzfeldt-Jakob disease (CJD) is a rare neurodegenerative human disorder with an incidence of one case per 1000000 per year. Recently new diagnostic tests such as neuron-specific enolase (NSE), S-100, tau-protein and protein 14-3-3 have been established as markers in prion diseases. NSE is elevated in case of rapid nerve cell loss so quantitative measurement of NSE in cerebrospinal fluid (CSF) might correlate with the disease progression. To further evaluate this hypothesis we analysed longitudinal CSF samples from 16 CJD patients. The first spinal tap was taken two weeks after the first clinical signs of a neurodegenerative disorder. This showed an elevation of NSE which continued during the course of the disease. Longitudinal examination of neuron-specific enolase in cerebrospinal fluid therefore may be useful for differentiation between CJD and other dementias.

The characterization and sequence analysis of thirty CTG-repeat containing genomic cosmid clones.

Eur J Hum Genet 1998 Jan;6(1):89-94 
Philibert RA, ..., Brennan MB, Palotie A, Ginns EI
We have systematically isolated and characterized DNA containing large CTG (n > 7) repeats from a human cosmid genomic DNA library. Using a CTG10 probe, more than 100 cosmid clones were identified, and 30 of these have been extensively characterized. The sequenced cosmids contain repeats that are between three and 19 perfect units (average 10 perfect repeats).

The cosmids map to at least 12 different chromosomes. Sequence analysis of flanking regions suggests that more than one third of the repeats occur in exons, and many share strong sequence identity with databank sequences, including the gene involved in dentatorubral pallidoluysian atrophy (DRPLA).

Genotyping of human DNA samples demonstrates that more than half of the repeats are polymorphic. This and similar collections of clones containing trinucleotide repeats should aid in the identification of genes that may contain expansions of trinucleotide repeats involved in human disease.

Association of an X-chromosome dodecamer insertional variant allele with mental retardation.

Mol Psychiatry 1998 Jul;3(4):303-9 
Corrigenda 197 Molecular Psychiatry March 1999, Volume 4, Issue 2
Philibert RA, King BH, Winfield S, Cook EH, Lee YH, Stubblefield B,
Damschroder-Williams P, Dea C, Palotie A, Tengstrom C, Martin BM, Ginns EI
Mental retardation is a prominent feature of many neurodevelopmental syndromes. In an attempt to identify genetic components of these illnesses, we isolated and sequenced a large number of human genomic cosmid inserts containing large trinucleotide repeats. One of these cosmids, Cos-4, maps to the X-chromosome and contains the sequence of a 7.3-kb mRNA. Initial polymorphism analysis across a region of repetitive DNA in this gene revealed a rare 12-bp exonic variation (<< 1% in non-iII males) having an increased prevalence in non-Fragile X males with mental retardation (4%, P < 0.04, n = 81).

This variant was not present in the highly conserved mouse homologue that has 100% amino acid identity to the human sequence near the polymorphism. Subsequent screening of two additional independent cohorts of non-Fragile X mentally retarded patients and ethnically matched controls demonstrated an even higher prevalence of the 12-bp variant in males with mental retardation (8%, P < 0.0003, n = 125, and 14%, P < 0.10, n = 36) vs the controls. Multivariate analysis was conducted in an effort to identify other phenotypic components in affected individuals, and the findings suggested an increased incidence of histories of hypothyroidism (P < 0.001) and treatment with antidepressants (P < 0.001). We conclude that the presence of this 12-bp variant confers significant susceptibility for mental retardation.

The Heparin binding site on apo-serum amyloid A: implications for the therapeutic intervention of amyloidosis

J. Biol. Chem. 1999 274(11): p. 7172-7181 $4.00
John B. Ancsin and Robert Kisilevsky
"Serum amyloid A isoforms, apoSAA1 and apoSAA2, are apolipoproteins of unknown function that become major components of high density lipoprotein (HDL) during the acute phase of an inflammatory response. ApoSAA is also the precursor of inflammation-associated amyloid, and there is strong evidence that the formation of inflammation-associated and other types of amyloid is promoted by heparan sulfate (HS). Data presented herein demonstrate that both mouse and human apoSAA contain binding sites that are specific for heparin and HS, with no binding for the other major glycosaminoglycans detected...Our present work provides direct evidence that apoSAA can associate with HS (and heparin) and that the occupation of its binding site by HS likely caused the previously reported increase in amyloidogenic conformation (beta-sheet) of apoSAA2 and their amyloid-suppressing effects in vivo. "

"One of these tissue injury acute-phase (AP) proteins is a novel HDL apolipoprotein, called serum amyloid A (apoSAA), which is encoded by a multigene family conserved from fish to humans [4 known in humans, salmonid SAA is 70% identical to mammalian AP SAA]...ApoSAA was originally identified by its cross-reactivity with antisera raised against peptides isolated from inflammation-associated amyloid (AA amyloid) which is a pathological tissue deposit associated with chronic inflammatory diseases. Amyloid is a generic term describing the primarily extracellular accumulation of fibrillar protein deposits that have unique tinctorial and structural properties and that cause the disruption of tissue architecture and function. ApoSAA and at least 17Ýother unrelated normally nonfibrillar proteins are known precursors of amyloid. [(1993) Bull. W.H.O. 71, 105-108 ]"

"Taurine (2-aminoethylsulfonate), a cysteine catabolite, and Congo Red (sodium diphenyldiazo-bis--naphthylaminesulfonate, CR), an acidic diazo dye used to stain amyloid deposits, are mono- and disulfonate compounds, respectively. The sulfonate groups in CR are spaced 19.3݉Ýapart (Fig. 7A). Both taurine and CR also have amino groups which facilitated their coupling to Sepharose 4B and oriented their sulfonate groups away from the matrix surface. For taurine-Sepharose 4B, the sulfonates would be randomly distributed, but for CR-Sepharose 4B they would be organized in regularly spaced pairs. m27-mer binding was only detected for CR-Sepharose and was retained through electrostatic interactions since desorption required increased NaCl concentration (Fig. 7B)...This also indicated that the spacing of the anionic groups on CR was important for binding and possibly mimics the sulfate spacing in the apoSAA-binding motif on HS. "

"Heparin sulfate (H) has in fact been found in all amyloid deposits that have been investigated (19). High affinity binding between perlecan and three Alzheimer's amyloid (A) precursors, PP-695, PP-751, and PP-770, could be inhibited with dextran sulfate and heparin but not chondroitin sulfate or dermatan sulfate (29). HS has also been found to enhance A fibrillogenesis (30), and analogs of HS (aliphatic polysulfonates) were recently reported to block HS-induced A fibrillogenesis, in vitro, and interfere with in vivo AA-type amyloid accumulation in mice (31, 32). Congo Red (CR), a disulfonated acidic dye, which has long been used as a stain for amyloid (33), can inhibit AA amyloid in vivo (34). CR and a number of sulfated glycans have also been shown to prevent the accumulation of the protease-resistant prion protein (amyloid form) (35-37). " ...

"From a pathological perspective, the apoSAA-HS binding activity is consistent with a view that most or all amyloid types are formed by an initial fibrillogenic amyloid precursor-HS interaction (17, 19, 20). It may also explain a number of previously reported observations concerning AA amyloidogenesis, namely the co-localization of HS with AA amyloid fibrils, the HS-induced -sheet conformational change in apoSAA2 (27), and the inhibition of AA amyloid by alipathic sulfonates designed to simulate HS (31). In addition to apoSAA and apoA-I, a mutant form of which can deposit as amyloid in the peripheral nervous system (familial polyneuropathy) (70), heparin/HS binding activity has been demonstrated for three other amyloid precursors, A and PP (29, 71), prions (72, 73) and amylin (74, 75). "

"If the linear distance between the two outer basic residues of most HS-binding sites are arranged in 20-‰ intervals, as Margalit and co-workers suggest (45), this information may prove useful in the design of anti-amyloid drugs that would be effective for a variety of amyloids. The effectiveness of CR in binding to the apoSAA heparin/HS-binding site and preventing both AA (34) and prion amyloid deposition in vivo (35-37) may be due to the spacing of its sulfonates.

This agent which potentially aligns with two basic residues within the binding site allows electrostatic interactions to take place blocking potential amyloidogenic interactions with HS. ... Of the polysulfonates examined, polyvinylsulfonate was found to be the most effective at preventing AA amyloid formation in vivo. Computer modeling of the energy-minimized structure for the repetitive subunit of polyvinylsulfonate predicts the spacing of the sulfonates to be about 5.4 ‰, placing every fourth sulfonate approximately 20 ‰ apart (76). "

"Heparin and heparan sulfate (HS) belong to a family of linear heteropolysaccharides called glycosaminoglycans (GAGs), which are normally synthesized linked to a protein core (proteoglycans) (38, 39). The GAG chains consist of up to a hundred disaccharide repeats composed of a hexuronic acid and a hexosamine. The hexuronic acid is either -D-glucuronic (GlcUA) acid or the C-5 epimer -L-iduronic acid (IdceA), and the hexosamine is glucosamine (GlcN), with N- and O-sulfation at various positions in the disaccharide repeats....HS is found ubiquitously on cell surfaces and within the extracellular matrix. Given the limited anatomic distribution of heparin, binding studies with HS may be the more relevant.... Margalit and colleagues (45) have found that by comparing the spatial distribution of the basic residues for 18Ýknown heparin binding domains, for which three-dimensional structures were available, two basic residues were always about 20݉Ýapart (20.3-23.5‰). In binding sites with an -helical or -strand conformation, the two basic residues were separated by 13Ýand 7Ýresidues, respectively, without a discernible consensus sequence. "

UK research projects in TSEs

MRC research page gives dollar amounts.
Note not a single projects address continuing problems in English zoos. 
"Refurbishment of the MRC Primate Facility (MRC)  Dr A F Dixon, Cambridge"  suggests experimental infections are planned.
Phenotypic variation in CJD: a clinical, pathological and molecular biological study (MRC)
Dr J W Ironside, Edinburgh

A study of temporal and spatial clustering of new variant and classic, sporadic CJD (DH)
Prof P Smith, London

An investigation of the relevance of 'florid plaques' in the diagnosis of vCJD (MRC)
Dr R Ridley, Cambridge

CJDSU: case control study (DH)
Dr R Will, Edinburgh

Development of model for neuropathological surveillance of the elderly population for CJD (DH)
Prof J Lowe, Nottingham

The extent of misclassification at death of CJD (DH)
Prof M Coleman, London

Possible underascertainment of nvCJD: a systematic retrospective study (DH)
Dr R Salmon, Cardiff

To undertake prospective multisource surveillance for all cases of Progressive Intellectual and Neuropathological Deterioration occurring in children in the UK (DH)
Dr C Verity, Cambridge

Survey of Oxford autopsy brain tissue for evidence of CJD (DH)
Prof M Esiri, Oxford

The research on risk perception of the population in relation to prion diseases
Not funded

The demonstration and immunostaining of small viruslike particles in scrapie rodent brain (MAFF)
Mr M Stack, Central Veterinary Laboratory

Characterisation of the molecular processing of the prion protein (MRC)
Dr N M Hooper, Leeds

Neurotoxicity of prion peptides (MRC)
Dr A Wallace, Belfast

A transgenic transmission facility for human prion disease (MRC/DH)
Prof J Collinge, London

RNA aptamers against disease isoform bovine prion protein (BBSRC)
Dr W S James, Oxford

A study of genes with altered expression in PrP null mice to identify the function of PrP (BBSRC)
Dr J C Manson, IAH

Nature of the scrapie agent: characterisation of candidate nucleic acids (BBSRC)
Dr R A Somerville, IAH

The mechanisms of propagation, transport and pathogenesis including elucidation of possible common links with neurodegenerative diseases Investigation of the hypothesis that BSE is an autoimmune disease (MAFF)
Prof A Ebringer, London

Studies of the cellular and humoral responses of distal ileum mucosa and mesenteric lymph nodes in the pathogenesis of BSE (MAFF)
Mrs Y I Spencer, Central Veterinary Laboratory

Investigation into links between oxidative stress and BSE (MAFF)
Dr T C Martin, Central Veterinary Laboratory

Ultrastructural, morphological and immunocytochemical studies of TSE (MAFF)
Dr M Jeffrey, Central Veterinary Laboratory

Immunohistochemical detection of cellular perturbations in formal in fixed brain from cattle with neurological disorders (MAFF)
Mrs Y I Spencer, Central Veterinary Laboratory

Studies of graftderived PrP in the brains of PrP/ mice (MAFF) Dr M Jeffrey, Central Veterinary Laboratory

An ultrastructural study of brain stem neuroanatomical nuclei in BSEaffected cattle (MAFF)
Dr M Jeffrey, Central Veterinary Laboratory

Brain pathophysiology in experimental models of human TSEs (MRC)
Prof John Jefferys, Birmingham

Magnetic resonance investigation of the pathogenesis of spongiform encephalopathy (MRC)
Dr J D Bell, London

Do scrapie and CJD develop normally in mice with targeted deletion of the serum amyloid P gene (MRC)
Prof M B Pepys, London

Factors influencing the non-nutritive transit of proteins and particles across the human gut epithelium (MRC)
Prof A Ferguson, Edinburgh

Immune disruption of the PrPsc/PrPc interaction in murine scrapie (MRC)
Dr S Hawke, London

Inflammation in neurodegenerative disease: characterisation of pathways in murine scrapie (MRC)
Dr V H Perry, Oxford

Protein complexes that regulate intracellular signal transduction: Structure and regulation by phosphorylation (MRC)
Dr A Aitken, Edinburgh

Longterm expression of mutant PrP in the murine nervous system using a viral vector (BBSRC)
Prof Ý A C Minson, Cambridge

Study of mice with gene targeted alterations to the PrP gene (BBSRC)
Dr D W Melton, Edinburgh

An analysis of the loss of synaptic function in scrapieinfected CA pyramidal neurones of mouse hippocampus (BBSRC)
Dr N K Macleod, Edinburgh

Neuronal Pathology in CJD: an immunocytochemical study with quantitative macroscopic and microscopic analysis (BBSRC)
Dr I W Ironside, Edinburgh

An investigation of neuronal properties, synaptic function and plasticity in the brains of PrPnull and other PrPmutant mice (BBSRC)
Dr N K Macleod, Edinburgh

Membrane trafficking and expression of prion protein: their role in TSE (BBSRC)
Dr R Morris, London

Propagation of the PrP transition in cultured neural cells (BBSRC)
Prof J Brockes, London

Mechanism of biogenesis of the abnormal isoform of the prion protein in the transmissible encephalopathies (BBSRC)
Prof R J Mayer, Nottingham

Mechanisms of transmission of TSE agents from the intestine to lymphoid tissues (BBSRC)
Dr G G Macpherson, Oxford

An investigation of scrapie pathogenesis in the spleen using immunodeficient, transgenic and chimeric mouse models (BBSRC)
Dr M E Bruce, IAH

In vitro investigation of neuronPrPglia interactions in the pathogenesis of scrapie (BBSRC)
Dr A E Williams, IAH

Determining the mechanism of neuronal degeneration and its relationship to PrP in scrapie pathogenesis (BBSRC)
Dr J Fraser, IAH

Characterisation of the different strains, compare scrapie strains with BSE Straintyping of scrapie agent in meat and bone meal (MAFF)
Dr D Taylor, IAH

Strain typing of BSE pathogen in mice and comparison with strains from natural sheep scrapie (MAFF)
Dr M Bruce, IAH

BSE transmission in sheep (MAFF)
Dr J D Foster, IAH

Association of PrP gene noncoding region polymorphisms with incidence of natural scrapie in sheep and PrP expression (MAFF)
Dr N Hunter, IAH

The attack rate and phenotype of scrapielike disease on transmission to cattle of fresh & rendered pools of scrapie (MAFF)
Mr G A H Wells, Central Veterinary Laboratory

Studies of experimental BSE in genetically susceptible sheep (MAFF)
Mr M Dawson, Central Veterinary Laboratory

Scrapie straintyping and PrP analysis in cell culture (BBSRC)
Dr C R Birkett, IAH

Study of sheep PrP gene variants in transgenic mice (BBSRC)
Dr N Hunter, IAH

Scrapie strain variation and targeting in transgenic mice with glycosylation deficient PrP (BBSRC)
Dr J C Manson, IAH

The structure of both PrPc and PrPsc, the normal function of PrPc and the mechanisms of conversion of PrPc into PrPsc in vitro Carbohydratemediated interactions of PrPc (MRC)
Dr T Feizi, London

Structure and function of the prion protein PrPc (MRC)
Prof D I Stuart, Oxford

Defining the role of PrP in normal development and neurodegeneration in novel transgenic mice in which PrP gene expression is temporally and spatially controlled (MRC)
Dr A R Clarke, Dr J Manson, Edinburgh

Chaperone interactions with PrP (BBSRC)
Dr M E Cheetham, London

In vitro study of yeast prion structure, stability and folding (BBSRC)
Prof A R Fersht, Cambridge

Physical structure, folding and stability of PrP protein forms (BBSRC)
Dr J Hope, IAH

Structural studies on prion proteins and related molecules (BBSRC)
Prof G G Dodson, London

Studies on the "species barrier" in scrapie and BSE (MAFF)
Dr M Bruce, Edinburgh

Development of mouse models for study of human TSEs (MRC)
Dr J Manson, Edinburgh

Do bovine prions imprint their neurotoxic conformations on human prion precursor proteins? (MRC)
Dr B M Austen, London

Transmissions of CJD to mice (DH)
IAH Neuropathogenesis Unit, Edinburgh

Partially inactivated scrapie agent as a model for the species barrier (BBSRC)
Dr D M Taylor, IAH

Use of a transgenic model of human prion disease for transmission studies (BBSRC)
Prof J Collinge, London

Molecular analysis of putative genetic factors affecting BSE susceptibility (MAFF)
Dr J Williams, Roslin Institute

Host genetic factors in transmission and pathology of prion disease (MRC)
Dr S A Whatley, London

Identification and mapping of BSEsusceptibility genes in the mouse and human (MRC)
Dr I J Jackson, Edinburgh

Other support The pathogenesis of transmissible spongiform encephalopathies (MRC)
Dr C J Bostock, IAH

The susceptibility of New Zealand sheep to TSE infection and linkage with PrP genotypes (MAFF)
IAH Neuropathogenesis Unit, Edinburgh

Extended provision of bovine body fluids from preclinical BSE and control animals (MAFF)
Mr R Jackman, Central Veterinary Laboratory

Studies of the enhancement of reproducibility of PrP Scrapie detection after cold storage of scrapie affected tissue (MAFF)
Mr M J Stack, Central Veterinary Laboratory

Experimental production of bovine tissues for validation of BSE diagnostic tests (MAFF)
Mr R Hancock, Central Veterinary Laboratory

Provision of "Preclinical BSE" body fluid samples from bovines experimentally challenged with infected brain (MAFF)
Mr R Jackman, Central Veterinary Laboratory

Maintenance of a TS Efree sheep flock after importation from New Zealand (MAFF)
Dr H A Simmons, Central Veterinary Laboratory

Identification, selection and importation of TSE free sheep from New Zealand (MAFF)
Dr H A Simmons, Central Veterinary Laboratory

Reagent resource centre (BBSRC)
Dr C J Bostock, IAH

Development of an antemortem test for BSE & natural scrapie infection through the detection of abnormal deposits of PrP (MAFF)
Dr R A Somerville, IAH

Further analysis of nucleic acid differences between control & scrapie/BSE infected animals (MAFF)
Dr R A Somerville, IAH

PrP gene variants & their potential as marker for natural and experimental scrapie susceptibility in sheep (MAFF)
Dr N Hunter, IAH

Identification of BSE infection in cattle tissue (MAFF)
Dr H Fraser, IAH

Sensitivity studies of fibril detection techniques used in Electron Microscopy for the diagnosis of scrapie (MAFF)
Mr M J Stack, Central Veterinary Laboratory

Identification and characterisation of the scrapie agent from a low protein, high infectivity fraction of brain (MAFF)
Dr C J Bostock, IAH

Production and properties of PrP: EC IVth Framework collaboration (MAFF)
Mr R Jackman, Central Veterinary Laboratory

PrP gene codon and species susceptibility to scrapie like diseases (MAFF)
Mr M Dawson, Central Veterinary Laboratory

Production of polyclonal antisera to highly purified bovine PrP scrapie (MAFF)
Mr R Jackman, Central Veterinary Laboratory

Approaches to the identification of nucleic acids associated with the transmissible encephalopathies (MAFF)
Prof R Lathe, Edinburgh

Evaluation of miniblotting system to detect the abnormal protein (PrPsc) in neural and non neural tissues for the (MAFF)
Mr M J Stack, Central Veterinary Laboratory

Development of an ultrasensitive, time resolved fluoroimmunoassay for PrPSc (MAFF)
Dr J Hope, IAH

Subtractive panning of a nonimmunised phage display library: a rapid means of producing diagnostic antibodies (MAFF)
Mr R Jackman, Central Veterinary Laboratory

Using the chemistry of blood and urine as an aid to the diagnosis of BSE (MAFF)
Dr J Moorby , Dr R Nash, IGER

Further investigations of BSE specific markers, including ApoE, and the search for new markers (MAFF)
Dr T C Martin, Central Veterinary Laboratory

Characterisation and validation of a serum metabolite as a marker for BSE in the live animal: PHASE (MAFF)
Mr R Jackman, Central Veterinary Laboratory

Studies of the sensitivity and specificity of methods of PrP scrapie detection in animal TSEs (MAFF)
Mr M Stack, Central Veterinary Laboratory

BSE agent replication in bovine brain cell lines (MAFF)
Dr H A John, Moredun Research Institute

Pathogenesis of BSE in bovine brain cell lines (MAFF)
Dr H A John, Moredun Research Institute

The identification and characterisation of early diagnostic clinical and neuroimaging features of Creutzfeld Jakob Disease (MRC)
Dr M N Rossor, London

Immune Responses to Prion Proteins in Null Mice (MRC)
Dr P Minor, London

Development of a urine test for CJD (MRC)
Dr L R Bridges, Leeds

The development of panels of CSF for the evaluation of tests for CJD (DH)
Dr E Miller, London

Bacteriophage display antibodies recognising PrP (BBSRC)
Dr J R Young, IHA

Generation and validation of transgenic mice expressing multiple copies of sheep and bovine PrP gene alleles (MAFF)
Dr N Hunter, IAH

Development of mouse models for the study of bovine transmissible spongiform encephalopathy (MAFF)
Dr J C Manson, IAH

Studies to examine the pathogenicity, phenotype and pathogenesis of endemic scrapie in cattle (MAFF)
Central Veterinary Laboratory

An investigation of scrapie infectivity and PrP genotype in clinically normal cast ewes from infected flocks (MAFF)
Mr M Dawson, Central Veterinary Laboratory

An epidemiological study of sheep scrapie to determine means of natural transmission (MAFF)
Dr L Hoinville, Central Veterinary Laboratory

Transmission studies for the detection of BSE in sheep (MAFF)
Dr N Hunter, IAH

Gain information on use of resistant rams as method of controlling or eradicating scrapie (MAFF)
MAFFfunded Project

Transmissibility of BSE to domestic fowl by injection with brain homogenate (MAFF)
Mr G A H Wells, Central Veterinary Laboratory

Transmissibility of BSE to domestic fowl by oral exposure to brain homogenate (MAFF)
Mr G A H Wells, Central Veterinary Laboratory

Transmissibility of BSE to pigs by injection with brain homogenate (MAFF)
Mr G A H Wells, Central Veterinary Laboratory

Transmissibility of BSE to pigs by oral exposure to brain homogenate (MAFF)
Mr S A C Hawkins, Central Veterinary Laboratory

Comparative efficiencies of the bioassay of BSE infectivity in cattle and mice (MAFF)
Mr G A H Wells, Central Veterinary Laboratory

Transmissibility of scrapie to pigs by oral exposure to brain homogenate (MAFF)
Mr S A C Hawkins, Central Veterinary Laboratory

The exposure of British sheep and cattle to mites (MAFF) Dr J Chambers, Central Veterinary Laboratory

Replication of scrapie and BSE prions in mites (MAFF)
Dr A D MacNicoll, Central Veterinary Laboratory

Contribution of contaminated feed, maternal and lateral transmission to incidence of BSE in bovines born after (MRC)
Dr S Gore, Cambridge

The establishment and application of a BSE lesion profiling database (MAFF)
Dr M Simmons, Central Veterinary Laboratory

BSE: Epidemiological studies (MAFF)
Mr J W Wilesmith, Central Veterinary Laboratory

Comparative neuropathology of recently recorded scrapielike encephalopathies in animal species other than cattle (MAFF)
Mr G A H Wells, Central Veterinary Laboratory

The effect of selection against susceptibility to scrapie in a defined sheep population of the
Shetland Islands (SO) Dr W A C McKelvey, SAC Edinburgh

Epidemiology of scrapie in sheep (BBSRC)
Dr C J Bostock, IAH

The neuropathological monitoring of suspect BSE cases born in (MAFF)
Dr M Simmons, Central Veterinary Laboratory

Analysis of BSE cohort study data (MAFF)
Prof R Curnow, Reading

Aetiological studies of brainstem neuronal chromatolysis; a disorder clinically similar to BSE
MAFF

Bioassay if BSE infectivity in non neural tissues by intra cerebral inoculation of cattle (MAFF)
Mr S A C Hawkins, Central Veterinary Laboratory

Pathogenesis of experimental BSE in cattle (MAFF)
Mr G A H Wells, Central Veterinary Laboratory

Effect of oral inoculum dose on attack rate and incubation period of BSE in cattle (MAFF)
Mr S A C Hawkins, Central Veterinary Laboratory

Further studies of the effect of oral innoculum dose on attack rate and incubation period of BSE in cattle (MAFF)
Mr S A C Hawkins, Central Veterinary Laboratory

The potential exposure of the human population The epidemiology of TSEs in ruminants and assessment of possible associated risk to human health (MAFF)
Prof R M Anderson, Oxford

Risk of BSE infectivity in meat for human consumption (MAFF)
P Comer, DNV Industry Ltd

Occupational risk of CJD (DH)
Prof M Coleman, London

A cohort study of risk of CJD in people in the UK treated with human pituitary growth hormone (DH)
Prof A Swerdlow, London

Bioassay of infectivity in blood fractions from patients with CJD (DH)
Dr M Bruce, IAH

Investigation of the transmissibility of TSEs via blood (DH)
Prof C Bostock, Edinburgh

Measures to reduce contamination of meat & environment with CNS tissue during slaughter & processing of cattle & sheep (MAFF)
Dr D Tinker, BBSRC Silso

Research into the potential for neural embolism after captive bolt stunning and slaughter in cattle (MAFF)
Dr H Anil, Bristol

Investigations into the potential for neural embolism at stunning and slaughter in sheep (MAFF)
Dr H Anil, Bristol

Development and evaluation of a practical method for the removal of spinal cord from sheep carcasses (MAFF)
Meat and Livestoc Commission

The study of BSE in sheep and the possibility of its vertical transmission (MAFF)
Dr J D Foster, IAH

BSE: Embryo transfer studies (MAFF)
Dr A E Wrathall, Central Veterinary Laboratory

To determine if scrapie can be transmitted by transfer of embryos from ewes infected with scrapie to uninfected ewes (MAFF)
Dr W Mckelvey, Scottish Agricultural College, Edinburgh

Transmissibility of BSE to cattle by oronasal exposure to placentae of affected cattle (MAFF)
Mr S A C Hawkins, Central Veterinary Laboratory

BSE Embryo transfer studies ADAS input (revised July ) (MAFF)
MAFF funded Project

Investigation of the role of the embryo in maternal transmission of scrapie in sheep (MAFF)
Dr N Hunter, IAH

Studies to identify possible homologies between TSEs (MAFF)
Mr G A H Wells, Central Veterinary Laboratory

Treatment and prevention of SEs . Assessment and development of inactivation procedures currently used in industry The feasibility of using microwave techniques to destroy livestock carcasses (MAFF)
Mr P F Bloxham, Harper Adams Agricultural College

The effect of PrP genotype on the thermostability of scrapie agent (MAFF)
Dr D Taylor, IAH

BSE and scrapie agent susceptibility to laboratory facsimiles of rendering practices (MAFF)
Dr D Taylor, IAH

Practical aspects of inactivation of BSE and scrapie agents (MAFF)
Dr D Taylor, IAH

Design and synthesis of potential chemotherapeutic agents for the treatment of transmissible spongiform encephalopathies (MRC)
Dr I H Gilbert, Cardiff

Generation of cattle and sheep devoid of PrP
[not funded]

Molecular and clinical studies of prion diseases (MRC)
Prof J Collinge, London

The study of brain disturbance and restitution of function (MRC)
Dr R Ridley, Cambridge

Refurbishment of the MRC Primate Facility (MRC)
Dr A F Dixon, Cambridge

Neuropathogenesis Unit core support (BBSRC)
IAH

Mad Cow Home ... Best Links ... Search this site