Origin of extra prion repeat units
Disentangling slippage from editing
How many different insertion mutations will eventually be found?
Predicting the final list of allowed and forbidden OPRI mutations
Insertion alleles in other species
Acknowledgements and References
last modified 2 Dec 99 -- webmasterThe repeat unit itself is the unit of genetic change in most known mutations in this region. Deletions of a single unit are common polymormphisms both in humans and other species without a strong association with CJD. Insertions are much more varied, ranging up to insertion of 9 extra units (sometimes with associated point mutations). Exhaustive Medline searches, foreign-language journal searches, back searches from article bibliographies, and correspondence with researchers produced the following set of insertion mutations with distinct pedigrees (worldwide):
| Pattern | Slips | Extra | Total | BP | Family | Citation |
|---|---|---|---|---|---|---|
1 2 2...................3 4 | 0 | 0 | 5 | 0 | wild type | +Kretzschmar 1986 |
1 2 2.................2 3 4 | 1 | 1 | 6 | 24 | French 'GF' | +LaPlanche 1995 |
1 2 2a2...............2a2a4 | 2 | 2 | 7 | 48 | Dutch | + van Harten 2000 |
1 2 2 3...............2a2a4 | 2 | 2 | 7 | 48 | US Penn | +Goldfarb 1993 |
1 2 2 3 2...........2 2 3 4 | 2 | 4 | 9 | 96 | French 'JC' | +LaPlanche 1995 |
1 2 2 3 2 3...........2 3 4 | 2 | 4 | 9 | 96 | US 'Hay' | +Goldfarb 1991 |
1 2 2 2 2.........2 2 3 4 | 2 | 4 | 9 | 96 | English | +Campbell 1996 |
1 2 2 2 2.........2 2 3 4 | 2 | 4 | 9 | 96 | Japanese | +Isozaki 1994 |
1 2 2 3g2...........2 2 3 4 | 2 | 4 | 9 | 96 | no details | +Cervenakova 1998 |
1 2 2 3g2 3g..........2 3 4 | 2 | 4 | 9 | 96 | Italian | +Rossi Neurology 2000 |
1 2 2 3g 3g 3g......2 2 3 4 | 2 | 5 | 10 | 120 | German | +Windl 1999 |
1 2 2 3 2 2 2a........2 3 4 | 2 | 5 | 10 | 120 | German | +Windl 1999 |
1 2 2 3 2 3g........2 2 3 4 | 2 | 5 | 10 | 120 | US 'Kel' | +Goldfarb 1991 |
1 2 2 2a2 2a........2 2 3 4 | 2 | 5 | 10 | 120 | US | +Cervenakova 1995 |
1 2 2 3 2 2.........2 2 3 4 | 2 | 5 | 10 | 120 | Ukrainian | +Cochran 1996 |
1 2 2 3 2a2 2a......2 2 4 | 2 | 5 | 10 | 120 | no details | +Cervenakova 1998 |
??? | 2 | 5 | 10 | 120 | S. African | +Cervenakova 1998 |
1 2 2 2 3 2 3g......2 2 3 4 | 3 | 6 | 11 | 144 | English 'A' | +Poulter 1992 |
1 2 2 3 2 3g2.......3g2 3 4 | 3 | 6 | 11 | 144 | English | +Nicholl 1995 |
1 2 2 2 2 2 2.......2 2 3 4 | 3 | 6 | 11 | 144 | Basque | +Capellari 1997 |
1 2 2 3g2 2 3g......2 2 3 4 | 3 | 6 | 11 | 144 | Japanese | +Oda 1995 |
1 2 2 3g2 2 3g......2 2 3 4 | 3 | 6 | 11 | 144 | US | +Cervenakova 1995 |
1 2 2 3g2 2 2 ......2 2 3 4 | 3 | 6 | 11 | 144 | English | +Cervenakova 1998 |
1 2 2 2 2 2 2 ..... 2 3g3 4 | 3 | 6 | 11 | 144 | no details | +Cervenakova 1998 |
1 2 2c3 2 3 2 3.....2 3g3 4 | 3 | 7 | 12 | 168 | US/N UK 'Ald' | +Brown 1992 |
1 2 2 3 2 2 2 3g....2 2 3 4 | 3 | 7 | 12 | 168 | Japanese | +Tateishi 1991 |
1 2 2 3 2 2 2 2a2...2 2 3 4 | 4 | 8 | 13 | 192 | French M-E | +Laplanche 1999 |
1 2 2 3g3 2 2 2 2...2 2 3 4 | 4 | 8 | 13 | 192 | Dutch 'A' | +van Gool 1995 |
1 2 2 3 2 2 2 2 2...2 2 2a4 | 4 | 8 | 13 | 192 | Breton 'Che' | +Goldfarb 1992 |
1 2 2 3 2 3g2a2 2 2 3g2 3 4 | 4 | 9 | 14 | 21g | English | +Owen 1992 |
1 2 2 3 2 3 3g2 2a2 3 2 3 4 | 4 | 9 | 14 | 216 | German | +Kraseman 1995 |
Legend: + full text examined; annotated references are given below. There are 'several' additional insert kindreds from Germany that will be added soon. The only duplications, for 4x=96 and 6x=144, are shown in red; 18 distinct variants have been reported. The Japanese data will be available shortly -- more duplication would markedly affect estimates of ultimate number of variants. Note these families are10% of total data and independent pedigrees. The number of slips is calculated as per a model. Modified repeats , their terminology, and slippage ambiguity zones are defined in the following graphic.

However, some as-yet-unimagined mechanism could be responsible. For that reason, I develop below a number of specific predictions of the replication slippage model. If other mechanisms are developed -- provided they make differing predictions -- additional data could discriminate amongst them. While slippage has been proposed in many genetic settings, multi-stage slippage within a single event is apparently novel. Of course, the human prion gene repeat region provides a favorable mileau for slippage and interest in CJD has enabled an intensive screen.
The basic idea is that as DNA replication procedes through the prion gene, the daughter strand experiences slippage facilitated by complementarity to an earlier template repeat. Repeats, by their nature, are still complementary when misaligned by an integral multiple of 24 bp (the principal ambiguity zone is shown in dark blue above -- slippage need not respect repeat boundary end points). Exonuclease editing 3' to 5' is available to remove mismatches -- partial editing produces chimeric repeats. Progress of the replication fork may be affected by a unique feature of the prion gene, the conserved hairpin C whose function at the level of mRNA or DNA remains unknown.
Hairpin C takes up most of R1: AACCGCTACCCACCTCAGGGCGGTGGTGGCTGGGGGCAG N R Y P P Q G G G G W G Q
When replication resumes with slipped complementarity in place, the result is extra repeats. (See graphics and animations.) Longer complex repeats require multiple rounds of stalling, slipping, editing, and resuming replication until finally replication run-out occurs. This takes place within a single event (ie, not over generations). Note that the direction of replication in the opposite sense from transcription fits stalling as the fork reaches the hairpin; alternately, replication in the same sense as transcription fits hairpin snap-back after the replication fork passes through the hairpin, causing slippage.
Multi-stage slippage is progressive. That is, the first round of extra repeats strongly influences the second round, and so on, because it is the earlier round that must hybridize to template before strand synthesis can continue. This feature of the process drives iterated internal repeat patterns, eg R 1 2 2 3 2 3 2 3 4. The template, of course, never changes.
Note that CJD insertional disease, unlike polyglutamine repeat disorders, shows no indication of 'anticipation.' That is, a given insertional event is stable over generations: long repeats do not become longer. There is further no data supporting unequal recombination or gene conversion in progeny. The reason for this is probably the rarity of these events: an initial event does in fact provide more fodder as more repeats equals more opportunity for subsequent slippage events, but these still remain quite unlikely given the small numbers involved. Thus a weak version of anticipation is predicted here: the signature is a wing of the pedigree wherein descendants have even more insertions (or less -- deleted repeats -- for that matter).
There is every reason to doubt that the present set of known insertions is close to saturating what is possible. If 190 or 1900 pedigrees were known, instead of 19, the list of distinct insertions would surely be longer. [There is no data from India, Africa, South America, or mainland Asia.] Yet the possibilities are far from arbitrary concatenations of wildtype repeats. While specific single historical events are outside the reach of experimental methods, it is plausible in modelling to take each as the simplest possible event, ie, by invoking the minimal necessary number of slippage events possible, as shown in column 2 of the above table.
Note that the initial and terminal repeats R1 and R4 are only peripherally involved; repeats seen are invariably internal ones, involving multiples of R2 and R3. This is predicted by the slippage model to hold for subsequent data, for both insertions and deletions, in all species. Roughly, replication begins normally (initial run), then the first slippage occurs as enough potential for this is acquired. Once slippage has been set in motion, multiple slippages are enabled. The event usually terminates in a 'run-out' through the distal repeats of the form R2 R2 R3 R4. The process does not allow for extra R1 or R4.
The largest ambiguity zone is comprised of the last 6 codons of R1 and all of R2 and R2', for 66 base pairs. (This number varies by species.) A slippage of 24 bases anywhere within this zone, not necessarily in formal register with repeat starts, results in perfect complementarity. However, R3 and R4 have substantial potential for misalignment as well, especially if 1-2 mispairings are tolerated in the secondary ambiguity zone.
Point variants are generally not separate events; here they are coupled to the extra repeat generation mechanism. All variants are transitions; however very little of the potential for neutral third codon change is realized: the same changes occur over and over again in different families with varying repeats. The traditional notation of the point variants is potentially misleading: R2a might equally well be called R3c or an R23 or R43 chimera; its interpretation might be context-dependent. R3g might equally well be called R2c' or an R32 reverse chimera. R2c has no explanation other than an uncoupled point transition. It has been reported only once and is unlikely to represent sequencing error. [R2c occurs again in deletions in two pedigrees.] In the insertion allele collection, repeat R2a occurs 5 times, R3g 12 times.
| Base change differences | |||||||
| - | R2 | R3 | R4 | R2a | R2c | R3g | |
|---|---|---|---|---|---|---|---|
| R2a | 1 | 1 | 2 | 0 | 2 | 2 | |
| R2c | 1 | 3 | 3 | 2 | 0 | 2 | |
| R2g | 1 | 1 | 3 | 2 | 2 | 0 | |
Even though single unit deletions [leaving R1234] are common polymorphisms affecting 1-2% of the population, the case cannot be made that any of the extra repeat insertions began from this initial state, not surprising since only 20 pedigrees are known. [Cases are known of a point mutation, eg D178N, compounded with a deletion allele.] Further, there are no cases with an insertion on one allele and a deletion on the other (which in analogy to M129V might slow onset). The signature of a slippage upon a deletion would be recognizable in some instances: R123234 for example could only come from R1234. While a prediction of the slippage model, such events could be especially rare if four repeats has less tendency for slippage than the longer wildtype five repeats.
(to be continued)
The question is then, given these initial results and assumptions, how many different classes of insertion mutants will ultimately be found?
This is no different than fishing in a lake with N species all present in large number. If N=19, we would certainly not expect to catch all 19 species with only 20 castings. Viewing it as the birthday problem, there is a 50-50 chance in a group of 20 people of two with the same birthday (on a planet with N=280 days per year). Such an extreme result has only a 5% chance of occurence when N=70.
The best single estimate of N is fairly soft and critically dependent on the occurences of repeats, so the range of reasonable N is quite large. There is the issue of robustness in regards to the next data points. But the bottom line is safe: there must be many dozens of repeat insert variations that have not been detected so far.
At a fixed number of extra repeats, there can be various possibilites:
1 2 3 4 5 6 7 8 9 number of extra repeats 1 1 0 5 5 7 2 2 2 number of independent pedigrees in each class 0 0 0 1 0 1 0 0 0 number of known independent duplications - - - - - - - - - number of possible mutational classes at each lengthThe insertion data is up to: 1 2 3 4 5 6 7 8 9 number of extra repeats 1 1 0 5 5 7 2 2 2 number of distinct pedigrees = 2 It is hard to say from this whether, say, 3 extra repeats is forbidden or whether some cap exists on maximum repeat length. However, we are not seeing 12 or 15 or 39 extra repeats: the data are clustered in the 1-9 range centered on 4 extras, suggesting that more than 12-13 extra repeats will be quite rare.
The repeat insertion collection plus hairpin C (R1) together predict the direction of replication through the prion gene (not necessarily the same as the direction of transcription, of course).
Multi-stage replication slippage: While replication slippage is a well-known mutational mechanism in all life kingdoms and organelles, multi-stage slippage within a single genetic event is apparently novel and not documented before (though difficult to search the literature for). Deletions occur by a dual mechanism in the template strand and have possible outcomes mostly limited by the ambiguity zones. (In polyglutamine CAG disorders, multi-stage slippage may occur but is harder to discern because of ambiguity and events in successive generations.)
Notice a certain upside bias to the data: it may not be realized initally that widely separated families with the same mutation may ultimately prove to be in the same pedigree. Parentage is not always what it seems: there is adoption and children sired outside of marriage. These three effects can only serve to reduce the adjusted incidence of de novo insertion events giving rise to the same mutation. Since there is really no data except for Europeans and Japanese, the best scenario for a bona fide duplication is a repeat found in both populations.
It is instructive to 'collapse' the table of mutations to see the level of duplication when modified bases are ignored. This is somewhat ambiguous, but the 5X mutations could coalesce, as could two of the 6X, 7X, and 9X. The motivation would be to separate slippage events from editing events. Pure slippage provides a lower bound that is still quite high but showing signs of saturation. The idea here is to determine a set of event generators and to describe specific insertions allowed by their iteration. Examples of generators are:
IR: initial run, usually 122 or 1223
RO: final run-out, usually 2234, requires slippage into hairpin C
R3g: slippage of R3 with partial edit
R2a: slippage of R4 with partial edit
The list generator here is based on the notion that replication runs can be identified (equivalently, slippage event boundaries identified). This is inferred from collinearity, complementarity, 5' to 3' replication, the master template order, and visual inspection of the data. Example: 1 2 2 3 2 3 2 3 2 Y 3 4 is readily broken into runs.
Going through the full set of known mutations, a rather limited set of unique runs is obtained. These may well be a full saturated set of allowable runs even thought the global mutations are far from saturated. The set of allowable runs is then taken as generators of the set of allowable mutations.
The point mutations R3g and R2c are treated somewhat differently, as potential modifiers of certain runs. These are modelled as arising from partial editing of slight mismatches caused by slippage to imperfect complementarity. The data indicate that the R3g and R2c processes -- which occur over and over -- may represent a saturated set of the main modifiers.
The list of possible mutations is then written as strings of generators and modifiers. It is easiest to first generate unmodified strings and then have modifiers operate on these objects if proper substrates.
Note that the independent Japanese mutations could profoundly impact estimates of the total number of possible mutations if they come up as duplicates. Duplication seems more likely at 4X since there are far fewer possibilities than at 7X. Duplications can be weighed probabalistically after the list of allowed mutations is established.
Oda et al raise an interesting issue in comparing clinical and pathological differences between English and Japanese lineages of slightly 6x=144 inserts, R1222323g2234 and R1223g223g2234, both M129M E219E: can different phenotypes really be attributed to differences in the primary structure of the prion gene? Note that these are silent mutations affecting only the gene and mRNA; all 6x=144 repeat patterns are the same at the protein level. But even here, the repeat region may cleaved off by endopeptides and not even be present in the rogue conformer. Though appropriate antibodies are readily available, few investigators have determined the amino terminus of plaque prion or even whether wildtype allele participated; the amino terminus is still present at least in some situations [GSS: Kitamoto T et al Brain Res 545:319-321 (1991)]
The incidence of repeats mutation depends on its definition and the diligence with which pedigrees are unravelled. If a mutation occurred in 1794 , giving rising to 221 living descendants today (roughly half of whom will be affected), should this count as 1 event or 110? The former is more useful for purposes of understanding the molecular biology underlying the event; the latter for partitioning contemporary cases of CJD. Several insertions exhilbit no family history, attributable to a de novo event, lack of older records, low penetrance, or short innocuous repeat length. These cases include the Japaneses 4x and 7x cases, the 4x cirrhosis case with untestable illegimate father, and the English 9x case.
There is a trend to describe extra-insert cases with the acronym, OPRI (octapeptide repeat insertions). Previously, some cases had been lumped with GSS, which is already an unfortunate mixture of unrelated alleles. No comparable notation has been used for seemingly neutral deletions, though OPRD might serve. It would be far better if each molecular variant carried its own name, eg, it is a major irritant to other researchers if a Medline abstract mentions only OPRI or GSS without specifying R1222a2a34 or P102L. Haplotypes should also be given, ie GSS P102L 5Rdel V129M K219E. (Within large pedigrees where every individual is not genotyped, the disease-carrying chromosome is unlikely to have undergone recombination whereas codon 129 and 219 have a good chance of varying through outbreeding in European and Japanese lineages, respectively. (to be continued)
| length | genus species
| X43
| Gazella subgutturosa
| goitered gazelle
| X34
| Lama glama
| lama
| X34
| Saimiri sciureus
| squirrel monkey
| X23
| Bison bonasus
| wisent
| X23
| Bos primigenius taurus
| watussi
| X23
| Bos taurus
| bovine, long
| X23
| Tragelaphus strepsiceros
| greater kudu
| X21
| Giraffa camelopardalis
| giraffe
| |
|---|
+Laplanche, JL et al
Brain, Vol. 122, No. 12, 2375-2386, December 1999
R12232222a22234 8x Eleven family members affected over 5 generations. Prominent psychiatric features and early onset.
+Windl O, Giese A, ..., Kretzschmar HA
Molecular genetics of human prion diseases in Germany
See also: Skworc et al. Ann. Neurol 46:693-700 1999 clinical
Human Genetics, 105:244-252 1999.
R1223g3g3g2234 2 cases 3 cases examined, spongiform, blurred and fleecy immunostaining, plaque, and/or punctate deposits
R1223222a234 2 cases
van Harten, B W.et al.
A new mutation in the prion protein gene: A patient with dementia and white matter changes
Neurology 2000;55:1055-1057
R122a22a2a4 in 1 family member, others suspected, compare to R12232a2a4 for American 2x family.
+Goldfarb LV, Cervenakova L, Brown P, Gajdusek DC
In Transmissible Subacute Spongiform Encephalopathies pg 425-431
I Court, H Bodet eds. Elsevier, Paris 1996 ISBN: 2-906077-91-7 508 pages
Table II was the starting point for the update presented here.
+Kretzschmar H.A., Stowring LE, Westaway D, Stubblebine WW, Prusiner SB, DeArmond SJ
Molecular cloning of a human prion protein cDNA
DNA 5:315-324(1986)
Human prion first sequenced.
+Laplanche JL, Delasnerie-Laupretre N, Brandel JP, Dussaucy M, Chatelain J, Launay JM
Two novel insertions in the prion protein gene in patients with late-onset dementia.
Hum Mol Genet. 1995 Jun; 4(6): 1109-1111, no abstract.
1X=24, R122234 in patient GF, 4x=96, R1223322234 in patient JC, Paris
+Goldfarb LG, Brown P, Little BW, Cervenakova L, Kenney K, Gibbs CJ Jr, Gajdusek DC
A new (two-repeat) octapeptide coding insert mutation in Creutzfeldt-Jakob disease.
Neurology. 1993 Nov; 43(11): 2392-2394.
2X=48, R1222a2a34 1 family, NIH, Bethesda.
+Dementia [Japanese] 1994 8:363-371
Isozaki, E et al.
CJD presenting as frontal lobe dementia associated with a 96 base insertion.
4X=96, R122222234 article in Japanese, details uncertain
+Goldfarb LG, Brown P, McCombie WR, Goldgaber D, Swergold GD, Wills PR, Cervenakova L, Baron H, Gibbs CJ, Gajdusek DC
Transmissible familial Creutzfeldt-Jakob disease associated with five, seven, and eight extra octapeptide coding repeats in the PRNP gene.
Proc Natl Acad Sci U S A. 1991 Dec 1; 88(23): 10926-10930.
4X=96 R122323234 hepatic cirrhosis Hay, 5X=120 R122323g2234 American Kel, 6X=144 R1222323g2234 large English A family, 7X=168 R122c3232323g34 American Ald family, 8X=192 R122322222222a4 French Che family; 1 family each, screen of 535, recombination model, NIH, Bethesda
+Campbell TA, Palmer MS, Will RG, Gibb WR, Luthert PJ, Collinge J
A prion disease with a novel 96-base pair insertional mutation in the prion protein gene.
Neurology. 1996 Mar; 46(3): 761-766.
4X=96 R122222234, 1 case, London. Not same as hepatic 4X case.
+Cochran EJ, Bennett DA, Cervenakova L, Kenney K, Bernard B, Foster NL, Benson DF, Goldfarb LG, Brown P
Familial CJD with a five-repeat octapeptide insert mutation.
Neurology. 1996 Sep; 47(3): 727-733
5X=120 R122323g2234, 1 case of American Kel family, Ashkenazi, Naroditch, Ukranian origin.
+Am J Hum Genet (1995) 57 A 209. abstract, article never appeared
L.Cervenakova, LG Goldfarb, P Brown, K. Kenney, EJ Cochran, DA Bennett, R. Roos, DC Gajdusek
Three new PRNP genotypes associated with familial CJD. [Abstract only]
5X=120 Kel family, 5X=120 >R122a22a2234 new;
6X=144 same sequence as Japanese, different pedigree. all families 129 met
+Poulter M, Baker HF, Frith CD, Leach M, Lofthouse R, Ridley RM, Shah T, Owen F, Collinge J, Brown J.
Inherited prion disease with 144 base pair gene insertion. 1. Genealogical and molecular studies.
Brain. 1992 Jun; 115( Pt 3): 675-685.
6X=144 R1222323g2234, 1 case from 4 families dating to 1794, London.
-Nicholl D, Windl O, de Silva R, Sawcer S, Dempster M, Ironside JW, Estibeiro JP, Yuill GM, Lathe R, Will RG
Inherited CJD in a British family associated with a novel 144 base pair insertion of the prion protein gene.
J Neurol Neurosurg Psychiatry. 1995 Jan; 58(1): 65-69.
6X=144, R122323g23g234 1 case not earlier British kindred, Crumpsall, UK.
+Capellari S, Vital C, Parchi P, Petersen RB, Ferrer X, Jarnier D, Pegoraro E, Gambetti P, Julien J
Familial prion disease with a novel 144-bp insertion in the prion protein gene in a Basque family.
Neurology. 1997 Jul; 49(1): 133-141.
6X=144 R12222222234 non-congophilic, 1 family, Basque.
+Oda T, Kitamoto T, Tateishi J, Mitsuhashi T, Iwabuchi K, Haga C, Oguni E, Kato Y, Tominaga I, Yanai K.
Prion disease with 144 base pair insertion in a Japanese family line.
Acta Neuropathol (Berl). 1995; 90(1): 80-86.
6X=144 R1223g223g2234 M129M E219E, Japanese lineage, Ibaragi Prefecture, ~1907, not congopohilic.
-Clinton J, Forsyth C, Royston MC, Roberts GW
Synaptic degeneration is the primary neuropathological feature in prion disease: a preliminary study.
Neuroreport. 1993 Jan; 4(1): 65-68.
6X=144, 2 cases, London.
-Tateishi J.
[Recent advances in the research of Creutzfeldt-Jakob disease (CJD) and Gerstmann-Strussler syndrome].
Rinsho Shinkeigaku. 1991 Dec; 31(12): 1306-1308. Review. Japanese.
7X=168 R12232223g2234, 1 case in Japanese woman, Kyushu. Brief discussion of 4X and 6X: article apparently does not give repeat details. Also 17 families with P102L, 1 family with E200K, and Alsation family with A117V
+Brown P, Goldfarb LG, McCombie WR, Nieto A, Squillacote D, Sheremata W, Little BW, Godec MS, Gibbs CJ, Gajdusek DC
Atypical CJD in an American family with an insert mutation in the PRNP amyloid precursor gene.
Neurology. 1992 Feb; 42(2): 422-427.
7x=168 R122c32323223g34 American Ald family of northern English origin, NIH, Bethesda
-Dementia [Japanese] 1994 8:380-390
Mizushima, S et al.
A case of presenile dementia with a 7X=168 base pair insertion
7X=168 R12232223g2234 article in Japanese, details unavailable
+van Gool WA, Hensels GW, Hoogerwaard EM, Wiezer JH, Wesseling P, Bolhuis PA.
Hypokinesia and presenile dementia in a Dutch family with a novel insertion in the prion protein gene.
Brain. 1995 Dec; 118( Pt 6): 1565-1571.
8X=192 R1223g322222234, 1 Dutch case, different from other 8X case, Amsterdam.
-Goldfarb LG, Brown P, Vrbovska A, Baron H, McCombie WR, Cathala F, Gibbs CJ Jr, Gajdusek DC
An insert mutation in the chromosome 20 amyloid precursor gene in a GSS family.
J Neurol Sci. 1992 Sep; 111(2):189-194.
8X=192 R122322222222a4 congophilic, 1 French-Breton Che family
+G. Rossi, G. Giaccone, L. Giampaolo, S. Iussich, G. Puoti, M. Frigo, G. Cavaletti, L. Frattola, O. Bugiani and F. Tagliavini
CJD with a novel four extra-repeat insertional mutation in the PrP gene
G. Rossi Neurology 2000;55:405-410
R1223g23g234 patient and sister, Italian family
+Krasemann S, Zerr I, Weber T, Poser S, Kretzschmar H, Hunsmann G, Bodemer W
Prion disease associated with a novel nine octapeptide repeat insertion in the PRNP gene.
Brain Res Mol Brain Res. 1995 Dec 1; 34(1): 173-176.
9X=216 R1223233g22a23234, 1 case, Gottingen.
+Owen F, Poulter M, Collinge J, Leach M, Lofthouse R, Crow TJ, Harding AE
A dementing illness associated with a novel insertion in the prion protein gene.
Brain Res Mol Brain Res. 1992 Mar; 13(1-2): 155-157.
9X=216 R122323g2a2223g234 1 case, Manchester, UK.
+ Cervenakova, L et al [Pers. comm. 20 Aug 98]
Two other patients with unknown lineages were never published:
5x=120 R12232a22a224 on 129 Val [no 234 at end confirmed] and 6x=144 R122222223g34 on 129 Met on129Met.
Also found 4x=96 R1223g22234 on 129Met, apparently familial.
Also a case from South Africa with 5x repeats, sequence enroute.
Also one patient fom UK with 6 additional epeats:1223g2222234.
Oda et al. 6x sequence is confrmed to be a different lineage from US duplicative lineage.
Japanese 7x=168 is R12232223g2234.
Redundant, preliminary, further study same kindred, clinical, reviews:
+Collinge J, Brown J, Hardy J, Mullan M, Rossor MN, Baker H, Crow TJ, Lofthouse R, Poulter M, Ridley R
Inherited prion disease with 144 base pair gene insertion. 2. Clinical and pathological features.
Brain. 1992 Jun; 115( Pt 3): 687-710.
6X=144 R1222323g2234, the large family, London.
+Owen F, Poulter M, Shah T, Collinge J, Lofthouse R, Baker H, Ridley R, McVey J, Crow TJ
An in-frame insertion in the prion protein gene in familial Creutzfeldt-Jakob disease.
Brain Res Mol Brain Res. 1990 Apr; 7(3): 273-276.
6X=144 R1222323g2234, start of big kindred, Middlesex, UK.
+Owen F, Poulter M, Collinge J, Leach M, Shah T, Lofthouse R, Chen YF, Crow TJ, Harding AE, Hardy J.
Insertions in the prion protein gene in atypical dementias.
Exp Neurol. 1991 May; 112(2): 240-242.
6X=144 in 4 related families, 9x=216, 5 insertions found in 101 atypical dementias, details reported again in separate papers. Middlesex, UK
+Owen F, Poulter M, Lofthouse R, Collinge J, Crow TJ, Risby D, Baker HF, Ridley RM, Hsiao K, Prusiner SB
Insertion in prion protein gene in familial Creutzfeldt-Jakob disease.
Lancet. 1989 Jan 7; 1(8628): 51-52, no abstract.
6X=144 one family, preliminary version of paper.
+Duchen LW, Poulter M, Harding AE
Dementia associated with a 216 base pair insertion in the prion protein gene.
Brain. 1993 Jun; 116( Pt 3): 555-567.
9X=216 R122323g2a2223g234 clinical aspects of Owen 1992, London
-Watanabe R, Duchen LW
Cerebral amyloid in human prion disease.
Neuropathol Appl Neurobiol. 1993 Jun; 19(3): 253-260.
9X=216 probably Duchen case R122323g2a2223g234, 1 case, London.
-Goldgaber D, Goldfarb LG, Brown P, Asher DM, Brown WT, Lin S, Teener JW, Feinstone SM, Rubenstein R, Kascsak RJ
Mutations in familial CJD and GSS syndrome.
Exp Neurol. 1989 Nov; 106(2): 204-206.
-----, screen found no cases of previously described insert, probably Owen's 6x=144.
+Collinge J, Palmer MS
Molecular genetics of human prion diseases.
Philos Trans R Soc Lond B Biol Sci. 1994 Mar 29; 343(1306): 371-378. Review.
Reviews, new 4x=96 discussed
+Brown P, Goldfarb LG, Cathala F, Vrbovska A, Sulima M, Nieto A, Gibbs CJ, Gajdusek DC
The molecular genetics of familial Creutzfeldt-Jakob disease in France.
J Neurol Sci. 1991 Oct; 105(2): 240-246.
Reviews and has table of inserts and terminology
+Kenney K, Brown P, Little B
Insert mutation in Creutzfeldt-Jakob disease.
Neurology. 1995 Jul; 45(7): 1428, letter, no abstract.
2x=48 R1222a2a34, same family, claiming sporadic CJD not insert
+Vital C, Gray F, Vital A, Parchi P, Capellari S, Petersen RB, Ferrer X, Jarnier D, Julien J, Gambetti P
Prion encephalopathy with insertion of ocatpeptide repeats: the number of repeats determines the type of cerebellar deposits
Neuropath App Neurob 24: 125-130 1998
study of deposits in Basque 6x [non-congophilic] and Breton 8x cases [congophilic].
Uncertain:
-Neuropathol Appl Neurobiol 1998 Apr;24(2):125-130 Prion encephalopathy
with insertion of octapeptide repeats: the number of repeats determines
the type of cerebellar deposits.
-Neuropathol Appl Neurobiol 1993 Jun;19(3):253-260 Cerebral amyloid in
human prion disease. Watanabe R, Duchen LW
Clinical and neuropathological features of 216 base-pair insertion
-Am J Pathol 1992 Aug;141(2):271-277 The primary structure of the prion
protein influences the distribution of abnormal prion protein in the
central nervous system.Kitamoto T, Doh-ura K, Muramoto T, Miyazono M,
Tateishi JDepartment of Neuropathology, Kyushu University, Fukuoka,
Insertional polymorphism, a pointmutation in codon 102 or 117/129, and codon 129
(Val129) result in plaque-type PrP accumulations.
-Am J Hum Genet 1991 Dec;49(6):1351-1354 Presymptomatic detection or
exclusion of prion protein gene defects in families with inherited prion
diseases.Collinge J, Poulter M, Davis MB, Baraitser M, Owen F, Crow TJ,
Harding AE
After counseling, PrP gene analysis was performed in two families with a 144-bp insert
Molecular genetics of human prion diseases in Germany
O. Windl, A.Giese, T. Jacobsen, T. Bogumil, M. Neumann, T. Weber, S. Poser and H. Kretzschmar
2nd Workshop Neurogenetics in Germany, Munich, October 19-21, 1995
... we examined the PrP gene of German patients
One patient showed a large insert of 24 basepair repeats
[This may be the 9x=216 case of Krasemann et al.]
Neurobiology of Aging
Volume 17, Issue 4S, 1996
Supplement
ISSN 01974580
Different Pathology of Prion Diseases in Japan and Europe
Tateishi, J. and Kitamoto, T.
page S160
New variant prion protein in a Japanese family with Gerstmann-Straussler syndrome :
Clinicopathological, molecular genetic studies.
Furukawa, H., Tashiro, H., Tanaka, Y., Yutani, C., Yamaguchi, T., Kitamoto, T. and Tateishi, J.
page S25-S26
Variations in phenotype, genotype, and transmission rate of prion diseases in Japan
Kitamoto, T., Shibuya, S., Ryong-Woon, S., Furukawa, H. and Tateishi, J.
page S41-S42
Molecular Biology of Prion Diseases
Collinge, J.
page S112
Human prion diseases with variant prion protein.
Kitamoto T, Tateishi J
Philos Trans R Soc Lond B Biol Sci 1994 Mar 29;343(1306):391-398
... variant PrP including insertional polymorphisms belong to the plaque type prion diseases